To validate the microarray data, ncRNAs that were significantly differentially expressed in HA patients were selected for confirmation analysis by small ncRNA TaqMan quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis using the TaqMan MicroRNA Assays or the Custom TaqMan Small RNA Assays (Life Technologies). According to the manufacturer’s TaqMan Assay protocol, cDNA was reverse transcribed from 10 ng of total RNA using specific looped small RNA RT primers which allow for specific RT reactions that can discriminate mature small ncRNA sequences from their precursors. The cDNA was then amplified by PCR, which uses TaqMan minor groove binder probes containing a reporter dye (FAM dye) linked to the 5' end of the probe, a minor groove binder at the 3' end of the probe, and a non-fluorescence quencher at the 3' end of the probe. The design of these probes allows for more accurate measurement of reporter dye contributions than possible with conventional fluorescence quenchers. Relative expression of ncRNAs was determined using delta-delta Ct (ΔΔCt) method. Hsa-miR-106b was used as an endogenous control in all qRT-PCR experiments because our microarray analysis shows that it is abundantly expressed in the blood, has very little variance across samples, and is not significantly differentially expressed in RBCs from HA patients.
Custom taqman small rna assay
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Custom TaqMan™ Small RNA Assay is a real-time PCR-based tool designed for the detection and quantification of small RNA molecules, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs). The assay enables the rapid and sensitive analysis of specific small RNA targets in a variety of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (8 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (2 mentions)
Taqman universal master mix 2, by Thermo Fisher Scientific (2 mentions)
Taqman universal pcr master mix 2 no ung, by Thermo Fisher Scientific (2 mentions)
Lightcycler 96 instrument, by Roche (2 mentions)
Semi skirted pcr plates, by Bio-Rad (1 mentions)
Cfx connect machine, by Bio-Rad (1 mentions)
U6 snrna, by Qiagen (1 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (1 mentions)
Abi 7500, by Thermo Fisher Scientific (1 mentions)
Abi prism 7000 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Taqman real time pcr assay, by Thermo Fisher Scientific (1 mentions)
Superscript first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay primers for mir 210 and snorna 202, by Thermo Fisher Scientific (1 mentions)
Irdye 800cw streptavidin, by LI COR (1 mentions)
Hybond nx, by Cytiva (1 mentions)
Dnase, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Taqman small rna assay, by Thermo Fisher Scientific (1 mentions)
Goscript reverse transcriptase and random primers, by Promega (1 mentions)
20 protocols using custom taqman small rna assay
1
Validating Differentially Expressed ncRNAs in HA
2
TaqMan Small RNA Assay for DXZ4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Custom TaqMan small RNA assays (Life Technologies) were performed according to the manufacture’s protocol using 500 ng of RNA <200 nucleotides. A U6 snoRNA probe (Life Technologies) was used as internal standard. Probed small RNAs included the following: DXZ4-2183as tcaccttggcttgggggacctcgagagcggtcccgt, DXZ4-2259as cgtcaacgcacctttaagggcgagagcggtccgccg, and DXZ4-2355as cctatccccctggctcgctctc.
3
Quantifying Small RNA Expression in Gravid Adult Animals
4
Quantitative Analysis of snoRNA Expression
5
Quantification of miR858 and miR396
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
7 ng of total RNA was reverse‐transcribed using the TaqMan® microRNA reverse transcription kit (Applied Biosystems, USA) according to the manufacturer's protocol. Custom‐made primers were used specifically for miR858 and miR396 cDNA synthesis. Custom TaqMan® small RNA assays (Applied Biosystems, USA) were carried out for microRNA qPCR validation using custom‐made TaqMan® probe for miR858 and miR396. Expression values were calculated relative to the internal control miR396.
6
SARS-CoV-2 and HCoV-OC43 svRNA Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from virus-infected cells at the indicated time points, or from lungs and sera of hamsters 5 dpi using miRNeasy mini kits. RNA was reverse transcribed using TaqMan MicroRNA Reverse Transcription Kits (Applied Biosystems) and qPCR was performed using TaqMan Fast Advanced Master Mix (Applied Biosystems) according to the manufacturer's instructions. Stem-loop RT primer, primers and probes for qPCR were designed by Custom TaqMan Small RNA Assays (Applied Biosystems) based on the representative sequences of 5′ end svRNA from SARS-CoV-2 (ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTT) and HCoV-OC43 (ATTGTGAGCGATTTGCGTGCGTGCATCCCGTTTCACTGATCTCTTGTTAGATCTTTTTGTAATCTAAACTTT).
The speci city of the SARS-CoV-2 63-nt speci c stem-loop qRT-PCR was tested using corresponding 5′ end svRNA templates with different 5′ end lengths (43, 63, 150 and 265-nt) that were transcribed in vitro, followed by gel-puri cation as described above. For Calu-3 cell samples, TaqMan MicroRNA Assays for snRNA-U6 (001973) were used as controls for normalization of small RNAs from cells and the relative expression was calculated by the DDCt method using the 8 hpi samples as a reference with a set value of one relative unit. For hamster samples, 100 ng total RNA were used for qRT-PCR.
The speci city of the SARS-CoV-2 63-nt speci c stem-loop qRT-PCR was tested using corresponding 5′ end svRNA templates with different 5′ end lengths (43, 63, 150 and 265-nt) that were transcribed in vitro, followed by gel-puri cation as described above. For Calu-3 cell samples, TaqMan MicroRNA Assays for snRNA-U6 (001973) were used as controls for normalization of small RNAs from cells and the relative expression was calculated by the DDCt method using the 8 hpi samples as a reference with a set value of one relative unit. For hamster samples, 100 ng total RNA were used for qRT-PCR.
7
Validation of piRNA Expression in Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We further validated piR-48966*, piR-31355*, and piR-49145 expression by qRT-PCR in 60 tissue samples (20 NC, 20 GC, and 20 ADJ). For the detection of piRNA levels, the TaqMan MicroRNA Reverse Transcription Kit (Thermo Scientific) was used to generate cDNA, according to the manufacturer’s instructions. Real-time PCR was performed using a TaqMan Universal Master Mix II (Thermo Scientific) and custom probes (Custom TaqMan Small RNA Assays - Thermo Scientific). The probe sequences were: 5′-TGGGGCGAAGCTACCATC-3′ (piR-48966*), 5′-GGCCGTGATCGTATAGTGGTTAGTAC-3′ (pirR31355), and 5′-TGAGGTAGTAGGTTGTATGGTTTAG-3′ (piR49145). We used RNU6B as endogenous to allow the comparative Ct method. Assays were performed in triplicate on ABI 7500 (Applied Biosystems, Foster City, CA, USA).
Statistical analysis was performed by the Shapiro–Wilk test (Supplementary Table S7 ) followed by Kruskal–Wallis tests for multiple comparison and the Wilcoxon Mann–Whitney test to paired comparisons. The results were adjusted for multiple comparisons using Bonferroni’s correction. Adjusted p-values of <0.05 were considered statistically significant.
Statistical analysis was performed by the Shapiro–Wilk test (
8
Quantifying A40s-GSC Complex Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Binding kinetic for the A40s-GSC complex was determined by performing Custom TaqMan Small RNA Assays (Thermo Fisher Scientific). Fitting curves were designed by using GraphPad Prism 6 software.
9
Validation of Small RNA Expression in Breast Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT‐qPCR was performed to confirm the presence of SNORA80E (ENSG00000207475.1), SNORD103B (NCBI: 692235), SNORD59A (ENSG00000207031.1), and SNORD104 (ENSG00000199753.1) in a subset of the breast tissue samples (n = 28). The reverse transcription (RT) was performed according to the manufacturers’ instructions using 10 ng of total RNA, the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) and specific RT primers obtained from the Custom TaqMan Small RNA Assays (Thermo Fisher Scientific) for SNORA80E, SNORD103B, SNORD59A, SNORD104, and the endogenous control RNU48. qPCR was performed in triplicate using the Custom TaqMan Small RNA Assays for SNORA80E, SNORD103B, SNORD59A, SNORD104, and RNU48 (Thermo Fisher Scientific), TaqMan Universal PCR Master Mix II no UNG (Thermo Fisher Scientific), and the LightCycler 96 Instrument (Roche Diagnostics, Mannheim, Germany) according to manufacturers’ instructions.
The relative expression for each small RNA was calculated from the Cq values using the ΔΔCq method with a run calibrator sample (in LightCycler 96 software). Pearson correlation was used for calculating the correlation between the relative expression in log2 scale (RT‐qPCR) and the vst normalized read counts in log2 scale (small RNA‐seq).
The relative expression for each small RNA was calculated from the Cq values using the ΔΔCq method with a run calibrator sample (in LightCycler 96 software). Pearson correlation was used for calculating the correlation between the relative expression in log2 scale (RT‐qPCR) and the vst normalized read counts in log2 scale (small RNA‐seq).
10
qRT-PCR Validation of Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT‐PCR was performed to confirm the presence of DQ570994, DQ596932, DQ571955 in a subset of the breast tissue samples (n = 44). The reverse transcription (RT) was performed according to the instructions of the manufacturer using 10 ng of total RNA, the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) and specific RT primers obtained from the Custom TaqMan Small RNA Assays (Thermo Fisher Scientific) for DQ570994, DQ596932, DQ571955, and the endogenous control U6. qPCR was performed in triplicate reactions using the Custom TaqMan Small RNA Assays for DQ570994, DQ596932, DQ571955, and U6 (Thermo Fisher Scientific), TaqMan Universal PCR Master Mix II no UNG (Thermo Fisher Scientific), and the LightCycler 96 Instrument (Roche) according to manufacturers’ instructions.
The relative expression for each small RNA was calculated from the Cq values using the ΔΔCq method. Pearson correlation was used for calculating the correlation of the relative expression in log2 scale (qRT‐PCR) with normalized read count in log2 scale (small RNA‐seq).
The relative expression for each small RNA was calculated from the Cq values using the ΔΔCq method. Pearson correlation was used for calculating the correlation of the relative expression in log2 scale (qRT‐PCR) with normalized read count in log2 scale (small RNA‐seq).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!