Taqpath 1 step multiplex master mix no rox

The following primers were utilized: N1 Forward, 5’-GACCCCAAAATCAGCGAAAT-3’, N1 Reverse, 5’-TCTGGTTACTGCCAGTTGAATCTG-3’, N1 FAM probe, 5’-(FAM)ACCCCGCATTACGTTTGGTGGACC(3’-BHQ-1)-3’, RP Forward, 5’-AGATTTGGACCTGCGAGCG-3’, RP Reverse, 5’-GAGCGGCTGTCTCCACAAGT-3’, and RP Cy5 Probe 5’-(Cy5)TTCTGACCTGAAGGCTCTGCGCG(3’-BHQ-3)-3’. 20 μL reactions (15 μL master mix + 5 μL RNA) were prepared using TaqPath™ 1-Step Multiplex Master Mix (No ROX) (ThermoFisher Cat. # A28523) and 20X primer/probe mix. The final primer concentrations per reaction were: N1 Forward & Reverse Primers (400 nM), N1 Probe (200 nM), RF Forward & Reverse Primers (200 nM), and RP Probe (100 nM). The plate was run on the QuantStudio 7 under the following conditions: 25°C for 2 min, 53°C for 10 min, 95°C for 2 min, and 45 cycles of 95°C for 3 sec then 60°C for 30 sec. Fluorescence was detected at the end of each 60°C cycle.

Nucleic acid extractions were performed with the Kingfisher Flex Instrument (ThermoFisher Inc., Waltham, MA, USA), using the MagMAX™ Viral/Pathogen Nucleic Acid Isolation Kit (Cat # A48310, ThermoFisher Inc., Waltham, MA, USA) according to the manufacturers’ instructions. The MVP_Flex_200ul protocol was used with an elution volume of 100 µL. Human specimen control (HSC; A549 cell suspension) was included as an extraction control and water as a negative control.
QRT-PCR testing of specimens targeting the N-gene of SARS-CoV-2 was performed on the ABI 7500 Fast Dx Real-time PCR system (Applied Biosystems, ThermoFisher Inc., Waltham, MA, USA) using the CDC influenza SARS-CoV-2 (FluSC2) multiplex assay (https://www.fda.gov/media/139743/download; kit Cat # Flu SC2-EUA, accessed on 29 April 2022). TaqPath™ 1-Step Multiplex Master Mix (No ROX) (Cat # A28522, ThermoFisher Scientific Inc., Waltham, MA, USA) was used to further test the qRT-PCR negative specimens for β-Actin to verify successful RNA extraction.

Melting curve analysis was performed using a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) to assess the thermodynamic characteristics of the molecular beacons. The molecular beacons were tested with no target in the presence of the correct target and the incorrect target. The final reaction volume of the molecular beacon with no target was 25 μL and consisted of 5 μL of 4× TaqPath™ 1-Step Multiplex Master Mix (No ROX) (Life Technologies, Frederick, MD, USA), 3 μL (5 pmol/μL) of molecular beacon, and 17 μL of nuclease-free H₂O. The reactions with the target (correct or incorrect) also contained 1 μL of target (100 pmol/μL) (correct/incorrect) and 16 μL of nuclease-free H₂O (instead of 17 μL). The PCR cycling conditions consisted of 1 cycle for 2 min at 95 °C, followed by 50 cycles split into two steps: the first step, during which fluorescence data were collected, was at 80 °C for 30 s, decreasing by 1 °C per cycle; the second step was at 80 °C for 10 s, decreasing by 1 °C per cycle. Fluorescence was measured at 535 nm for HEX and was recorded at each cycle. Following the completion of the run, the fluorescence signal data were normalized and plotted.

Real-time RT-PCR was performed using a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with 4× TaqPath™ 1-Step Multiplex Master Mix (No ROX) (Life Technologies, Frederick, MD, USA). Each 30 μL reaction consisted of 5 μL of RNA, 7.5 μL of 4× TaqPath™ 1-Step Multiplex Master Mix, 1.5 μL of 20 pmol/μL of each primer, 3.0 μL of 5 pmol/μL molecular beacon, and 11.5 μL of nuclease-free H₂O. The primers and molecular beacons used are shown in Table 1. The reverse transcription cycling conditions consisted of 1 cycle at 25 °C for 2 min, followed by 1 cycle at 53 °C for 10 min and 1 cycle at 95 °C for 2 min. This was followed by 5 cycles at 95 °C for 3 s and 53 °C for 30 s. Finally, 35 cycles at 95 °C for 3 s and 53 °C for 30 s were performed, during which data collection occurred. In these runs, no-template controls (NTCs) (nuclease free H₂O) and SARS-CoV-2 RNA BetaCoV/Germany/BavPat1/2020 p.1” grown in cell culture, B.1 lineage (EVAg, Charité, Berlin, Germany) or UVE/SARS-CoV-2/2020/FR/702 (MT777677.1) (EVAg, Charité, Berlin, Germany) were used as negative controls. A sample was considered positive when the fluorescence signal exceeded the threshold line before the 40th cycle. Following the completion of the run, the fluorescence signal data were plotted.