Liz 500 size standard

All individuals were genotyped for 46 AIMs [46 (link)] using a multiplex PCR amplification, as done in previous studies [25 (link),26 (link)]. In brief, each PCR reaction was a mixture of 5μl 2× Qiagen Multiplex PCR Master Mix, 1μl 10× Primer Mix, 0.5μl DNA (concentration between 0.5-5ng/μl), and 3.5μl water. The samples were prepared for capillary electrophoresis by adding 11.5μl Hi-Di Formamide (Applied Biosystems) and 0.3μl Liz-500 Size Standard (Applied Biosystems) to 0.8μl PCR product. A 3130xl Genetic Analyzer (Applied Biosystems) was used to separate DNA fragments by size. Analysis of indels was conducted by applying the software GeneMapper (Applied Biosystems). The genotyping results are reported in S5 Table.

Multicapillary electrophoresis of the amplification products was performed on an ABI Prism 3100 Avant Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using LIZ 500 size standard (Applied Biosystems, Foster City, CA, USA) provided with the kit and the data was analysed using GeneMapper™ 3.5 Software (Applied Biosystems, Foster City, CA, USA). All steps were done according to the Laboratory’s internal control standards and respective kit controls, according to the IFSH recommendations (DNA recommendations 1994 (link)).

Sixteen embryos were randomly selected from each capsule for DNA extraction which was performed according to the following protocol: each embryo was incubated for 3 h at 56°C with 20 µl of lysis buffer (10 mM Tris-HCl PH8.3, 50 mM KCl, 0.5% Tween-20, 500 µg/ml proteinase K), followed by 15 min at 95°C [35] (link). Samples were then centrifuged at 3000 rpm for 2 min to pellet cellular debris.
Genotyping of microsatellites was conducted using fluorescently-labeled primers and an automated ABI3730 XL DNA sequencer. Five microsatellite loci (TB19, QR43, R12, R13, RV11), were amplified following the PCR protocol described in [36] (link). PCR products were electrophoresed on an ABI3730 XL DNA sequencer with the LIZ-500 size standard (Applied Biosystems). Data were analyzed using GeneMarker v2.2 (SoftGenetics, State College, PA, USA). Probably because of low DNA quality, two of the loci (R12 and RV11) were not genotyped successfully in some families (Locus R12 for Family 2, 6, 9 and 10, Locus Rv11 for Family 1, 3, 4 and 15). These loci were excluded for the subsequent analyses of parentage for these families.

For individual identification from the confirmed dhole scats, we used the earlier validated 12 microsatellite loci panel described in Modi et al.^{26 (link)} (Supplementary Table 1). We performed PCR reactions in 10 μl reaction volumes containing 4 μl of Multiplex master mix (QIAGEN Inc., Hilden, Germany), 4 μM (2.5 μl) BSA, 0.5 μM of primer mix and 3 μl of DNA extract with PCR conditions including initial denaturation (95 °C for 15 min); 50 cycles of denaturation (94 °C for 30 s), annealing (50 °C for 30 s) and extension (72 °C for 35 s); followed by a final extension (72 °C for 10 min)^{26 (link)}. Negative and extraction controls were included to monitor contaminations. Amplified products were mixed with HiDi formamide and LIZ 500 size standard (Applied Biosystems, California, United States) and genotyped in an ABI genetic analyzer (Applied Biosystems, California, United States). We scored the fragment lengths manually using the same reference sample and following stringent criteria described in Modi et al.^{26 (link)}. All samples were genotyped three independent times to ensure good data quality for subsequent analyses. We have also included 101 individual genotypes from our previous study^{26 (link)} collected from five protected areas (MTR, TATR, PTR, NNTR, UKWLS) along with the newly generated data for further analysis.

Primer XE2: 5′‐GCCCTCCCGCCCAGCTAAAAGTGTCCGGG‐3′ (labeling FAM)
Primer 603: 5′‐CCTGTGAGTGTGTAAGTGTGTGATGCTGCCG‐3′
For each sample, the reaction mixture (21 μl) was prepared in 384 well plates, each containing 1 μl (50 ng) of human genomic DNA, 10 μl QIAGEN Multiplex PCR Plus Kit (Qiagen, Hilden, Germany), 6 μl Q‐Solution (Qiagen) and 4 μl VIC‐ or FAM‐labeled forward primer and unlabeled reverse primer (190 nM final each). The cycling program was carried out after a preheating step at 98°C for 5 min and included 35 cycles of: (1) denaturation at 98°C for 45s, (2) annealing at 68°C for 2 min and (3) extension at 72°C for 2 min, followed by a final extension step at 72°C for 20 min in a DNA Thermal Cycler (PTC‐200 MJ Research, Bio‐Rad, Munich, Germany). The amplicons were separated using size electrophoresis on the ABI 3730 XL DNA Analyzer. Samples were diluted 1:50 with 0.3 mM EDTA and 4 μl was mixed with 6 μl LIZ‐500 Size Standard (Applied Biosystems, Foster City, CA, USA). Raw data were processed using the Gene Mapper Software 4.0 (Applied Biosystems). Overall, successfully genotyped markers amounted to 98.1%.