Rnaase a

The fine powdered mycelium (30 mg) was resuspended and lysed in lysis buffer (500 µL) by pipetting multiple times until the suspension became foamy. RNAase A (EN0531, Thermo Scientific, Waltham, MA, USA) was added and the mixture was incubated for 5 min at 37 °C. To remove the cell debris, polysaccharide and protein, NaCl₂ solution (165 µL, 5 mol/L) was added and the tube was inverted multiple times before centrifugation (13,000 rpm, 20 min, 4 °C). The resulting supernatant was transferred to a fresh tube and mixed with chloroform (400 µL) and phenol (400 µL) by gentle inversion of the tube multiple times until the solution turned cloudy. The mixture was centrifuged (13,000 rpm, 20 min, 4 °C) and the aqueous phase was removed and extracted using an equal volume of chloroform. DNA was precipitated using 95% ethanol (2 volumes) and purified from polysaccharide by the addition of lysis buffer (500 µL) and mixing by gentle pipetting. NaCl (165 µL, 5 mol/L) was added and mixed by gentle inversion multiple times. To extract the purified DNA, chloroform (2 volumes) was added and the sample was centrifuged (13,000 rpm, 10 min, 4 °C). DNA was precipitated using ethanol (95%) and washed three times in ice-cold ethanol (70%). The washed DNA was dried, dissolved in Tris-EDTA buffer (50 µL) and stored at −20 °C [19] (link).

Neuro2A cells were seeded in six wells (5 × 10⁵ cells/well), 24 h later, plasmids of miR-30c-OE, miR-30c-KD, and vehicle control were transfected into Neuro2A cells respectively (180 ng plasmids/well) with 1.8 μl lipofectamine 2000 (Invitrogen, CA, USA). 18 h post-transfection, the cells were harvested and incubated with propidium Iodide (PI, Sigma, 50 μg/ml) and RNAase A (Thermo, 10 μg/ml) for 30 min at room temperature (Hui et al., 2013 (link)). Then, these cells were analyzed by calculating 10,000 cells per sample via flow cytometry (FlowCytometer, Beckman Coulter, Brea, CA). Cell-cycle was analyzed using Wincycle 32 software (Beckman Coulter, Brea, CA).

U2OS cells were transfected with 2 ug of HPV-18 minicircle and total RNA was extracted 72 h post transfection using TRI-Reagent lysis solution (Molecular Reasearch Inc.). An oligonucleotide Pr881 was used for the primer extension assay (5′ACACAAAGGACAGGGTGTTC3′). The oligonucleotide was end-labeled with (gamma-P32) Adenosine 5′triphosphate (ATP) (Hartmann Analytics GmBH) by T4PNK (Thermo Scientific). 50 µg of total RNA was annealed with the labeled Pr881 oligonucleotide at 58°C for 2 h and reverse transcription was performed using AMV-Reverse Transcriptase (Life Technologies). The samples were treated with 10 U of RNAase A (Thermo Scientific) after which samples were purified by phenol-chlorophorm extraction and ethanol precipitation. The samples were eluted after which formamide containing loading dye was added and then denatured at 100°C for 10 minutes. 50% of total volume was loaded directly on a 50 cm 6% denaturing-PAA sequencing gel. Gel was vacuum-dried and primer extension signals were obtained by phosphoimager scanning (GE Healthcare) and HPV-18 specific primer extension products were obtained and quantitated using Image Quant TL software (GE Healthcare).