Genequant pro spectrophotometer
The GeneQuant Pro spectrophotometer is a laboratory instrument used for the quantification and analysis of nucleic acids, such as DNA and RNA. It measures the absorbance of light by the sample, allowing users to determine the concentration and purity of the nucleic acids present.
Lab products found in correlation
8 protocols using genequant pro spectrophotometer
Preparation of P. aeruginosa Strains
RNA Isolation and RT-PCR Analysis of Mesenchymal Cell Differentiation
GLUT-2; CTGGGAAGAAGAGACTGAAGGA, and anti-sense ATACGCTTCTTCCAGCAATGAT. PDX-1; AACCGGAGGAGAATAAGAGGAC, and antisense CTTGTGTGTGGCGTTTAGGTTA.
Fru Modulates LPS-Induced Gene Expression
RNA Extraction and cDNA Synthesis
Quantitative Real-Time PCR Analysis of THP-1 Macrophages
Luciferase Assay Protocol
Characterization of Mucoid Pseudomonas Strains
Staphylococcus aureus Infection Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!