Pcl eco retrovirus packaging vector

Manufactured by Novus Biologicals

The PCL-Eco retrovirus-packaging vector is a laboratory tool designed to produce replication-incompetent retroviral particles. Its core function is to serve as a packaging system for the generation of recombinant retroviruses.

Automatically generated - may contain errors

Lab products found in correlation

Profection mammalian transfection system, by Promega (4 mentions) Polybrene, by Merck Group (4 mentions) Pgl2 basic, by Promega (2 mentions) Deae dextran, by Merck Group (1 mentions) Pmscv ires gfp, by Addgene (1 mentions)

Spelling variants of this product

PCL-Eco (17 citations) PCL-Eco packaging vector (5 citations)

10 protocols using pcl eco retrovirus packaging vector

Retroviral Transduction of Murine B Cells

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The miR-146a expression retroviral construct pMSCV-PIG-miR-146a (58 (link)) was a gift from Joshua Mendell (Addgene plasmid # 64234) and the pMSCV-PIG (Puro IRES GFP) empty vector was a gift from David Bartel (Addgene plasmid # 21654). To generate the retrovirus, pMSCV-PIG-miR-146a or empty pMSCV-PIG vector were used together with the pCL-Eco retrovirus-packaging vector (Imgenex) to transfect HEK293T cells by the calcium phosphate-mediated method (ProFection Mammalian Transfection System; Promega). Viral supernatants were harvested and used to transduce spleen B cells from C57BL/6 mice, as we reported (24 (link), 30 (link), 54 (link)), after a 12 h activation by LPS. Transduced B cells were then stimulated by LPS plus TGF-β, IL-4, IL-5, RA and anti-Igδ mAb for 96 h before analyzing GFP⁺ B cells for surface IgA expression as well as intracellular AID, Smad2, Smad3 and Smad4 expression.

Casali P., Li S., Morales G., Daw C.C., Chupp D.P., Fisher A.D, & Zan H. (2021). Epigenetic Modulation of Class-Switch DNA Recombination to IgA by miR-146a Through Downregulation of Smad2, Smad3 and Smad4. Frontiers in Immunology, 12, 761450.

+ Open protocol

+ Expand

Retrovirus-Mediated Megakaryocyte Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Retrovirus was produced using the pCL‐Eco Retrovirus Packaging Vector (Imgenex). HPC7 cells were infected with retrovirus in the presence of 8 μg/ml polybrene (Millipore). After 24 h, virus‐infected GFP‐positive cells were FACS‐sorted and cultured for another 48 h in IMDM supplemented with 10% FBS and 10% SCF‐conditioned media before megakaryocyte differentiation.

Park H.J., Li J., Hannah R., Biddie S., Leal‐Cervantes A.I., Kirschner K., Flores Santa Cruz D., Sexl V., Göttgens B, & Green A.R. (2015). Cytokine‐induced megakaryocytic differentiation is regulated by genome‐wide loss of a uSTAT transcriptional program. The EMBO Journal, 35(6), 580-594.

+ Open protocol

+ Expand

Murine Mast Cell Line Characterization and Genetic Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine mast cell lines FMP6- and MST have been described (McKinlay et al, 1998 (link)) (Elefanty & Cory, 1992 (link)) and characterised (Bockamp et al, 1998 (link)) previously. Cx3cr1 luciferase reporter constructs were custom-made (Life Technologies), cloned into pGL2basic (Promega) and confirmed by sequencing. Cells were transfected and assayed as previously described (Gottgens et al, 1997 (link)).
shRNA fragments were inserted into pMSCV/LTRmiR30-PIG: luciferase (5′ CACGTACGCGGAATACTTCGAA 3′ (Bot et al, 2005 (link))), Erg (5′ ACCTCCCAATATGACCACAAAT 3′), Gata2 (5′ CGCCGCCATTACTGTGAATATT 3′ (Huang et al, 2009 (link))), Fli1 (5′ ACCAGTGAGAGTCAATGTCAAG 3′), Pu.1 (5′ AGGATGTGCTTCCCTTATCAAA 3′) and Lmo2 (5′ CCCAGCCCTTAGAGAGAATTTA 3′). Retrovirus was produced using the pCL-Eco Retrovirus Packaging Vector (Imgenex). BMMCs were infected with retrovirus by centrifugation at 2,200 rpm at 32°C for 1.5 h with 4 μg/ml polybrene (Sigma-Aldrich) after which the retroviral supernatant was replaced with fresh media. After 48 h, GFP⁺-transduced cells were sorted and cultured further for 24 h before RNA extraction. Knock-down efficiency is shown in Supplementary Fig S8A.

Calero-Nieto F.J., Ng F.S., Wilson N.K., Hannah R., Moignard V., Leal-Cervantes A.I., Jimenez-Madrid I., Diamanti E., Wernisch L, & Göttgens B. (2014). Key regulators control distinct transcriptional programmes in blood progenitor and mast cells. The EMBO Journal, 33(11), 1212-1226.

+ Open protocol

+ Expand

Overexpression of miRNA-181a in Mouse B Cells

Cited 4 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

A mouse Mir181a retroviral expression vector was used for overexpression experiments. Briefly, a 270-bp miRNA gene segment containing the Mir181 miRNA hairpin was cloned from mouse chromosome 1 into MDH1-PGK-GFP expression vector. To generate the retrovirus, MDH1-PGK-GFP expression vector, encoding GFP, or MDH1-miR-181a-1-PGK-GFP expression vector, encoding GFP and miRNA-181a, together with the pCL-Eco retrovirus-packaging vector (Imgenex) were used to transfect HEK293T cells by a Ca²⁺ phosphate-mediated transfection procedure. Viral supernatants were harvested and used to transduce (by spinning at 400 g for 45 minutes followed by culture with LPS plus IL-4 for 72 hrs) LPS-preactivated (12 hr) C57BL/6 mouse spleen B cells, as we reported^{32 (link),84 (link)}. CD19⁺GFP⁺7-AAD⁻ transduced B cells were sorted by FAC^{32 (link)}. Expression of Rorα, Tox, Trerf1, Trpv3, and Rassf6 transcripts in B cells transduced with empty or Mir181-expression retroviral construct was analyzed by quantitative RT-PCR^{78 (link),85 (link)}.

Moroney J.B., Vasudev A., Pertsemlidis A., Zan H, & Casali P. (2020). Integrative transcriptome and chromatin landscape analysis reveals distinct epigenetic regulations in human memory B cells. Nature Communications, 11, 5435.

+ Open protocol

+ Expand

Characterization of H2a and Derived Constructs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

H2a and H2a mutated in its three glycosylation sites (H2aΔgly), subcloned in pCDNA1, were previously described (Kamhi-Nesher et al., 2001 (link); Groisman et al., 2006 ), as were H2aG78R fused through its C-terminus to H2a-RFP (Kondratyev et al., 2007 (link)), FLAG-tagged Herp (Okuda-Shimizu and Hendershot, 2007 (link)), β1,3-galactosyltransferase (GalT)–yellow fluorescent protein (YFP), and myc-tagged human HRD1 (Groisman et al., 2006 ; Kondratyev et al., 2007 (link); Avezov et al., 2008 (link)). Hemagglutinin (HA)-tagged BACE476 (Bernasconi et al., 2010 (link)) was a kind gift of M. Molinari (IRB, Bellinzona, Switzerland). S-tagged XTP3-B, S-tagged OS-9.1, and OS-9.2 (Christianson et al., 2008 (link)) were previously described (Shenkman et al., 2013 (link)). H2a subcloned using an EcoRI restriction site in MSCVpuro, H2aΔgly subcloned using EcoRI and BamH1 restriction sites in pMIG (Addgene, Cambridge, MA), and pCL-Eco Retrovirus Packaging Vector (Imgenex, San Diego, CA) were used for infections.

Leitman J., Shenkman M., Gofman Y., Shtern N.O., Ben-Tal N., Hendershot L.M, & Lederkremer G.Z. (2014). Herp coordinates compartmentalization and recruitment of HRD1 and misfolded proteins for ERAD. Molecular Biology of the Cell, 25(7), 1050-1060.

+ Open protocol

+ Expand

Retrovirus-Mediated Mouse B Cell CSR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pTAC and pTAC-AID retroviral vectors were as we described (13 ). For the generation of retrovirus, retroviral vectors were used to transfect along with the pCL–Eco retrovirus–packaging vector (Imgenex) HEK293T cells using the ProFection Mammalian Transfection System^® (Promega). Transfected cells were cultured in FBS-RPMI in the presence of chloroquine (25 μM) for 8 h. After the removal of chloroquine, retrovirus-containing culture supernatants were harvested every 12 h. For transduction and CSR analysis, mouse B cells were activated with CD154 plus IL-4 for 48 h and then incubated with viral particles that were pre-mixed with 6 μg/ml DEAE-dextran at 25°C for 30 m (Sigma-Aldrich). After incubation at 37°C for 5 h with gentle mixing every hour, cells were centrifuged at 500 g for 1 h and then 1,000 g for 4 m. Transduced B cells were cultured in virus-free FBS-RPMI in the presence of CD154 plus IL-4 for 72 h and then harvested for flow cytometry analysis of viability (7–AAD⁻) and surface IgG1 and CD19 expression. Dead (7–AAD⁺) cells were excluded from IgG1 and CD19 analysis.

Pone E.J., Lam T., Lou Z., Wang R., Chen Y., Liu D., Edinger A.L., Xu Z, & Casali P. (2015). B Cell Rab7 Mediates Induction of AID Expression and Class-Switching in T-dependent and T-independent Antibody Responses. Journal of immunology (Baltimore, Md. : 1950), 194(7), 3065-3078.

+ Open protocol

+ Expand

Sirt1 Overexpression in Mouse B Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sirt1 coding region cDNA was amplified from unstimulated mouse B cells using the appropriate primers (table S1) and cloned into the pMIG retroviral expression vector. To generate the retrovirus, the pMIG vector encoding green fluorescent protein (GFP) only or the pMIG-Sirt1 vector encoding GFP and Sirt1 was used with the pCL-Eco retrovirus-packaging vector (Imgenex) to transfect human embryonic kidney–293T cells by a Ca⁺⁺ phosphate (ProFection Mammalian Transfection System, Promega). Viral supernatants were collected and used to transduce spleen B cells from C57BL/6 mice after a 12-hour LPS activation, as we reported (6 (link)). Transduced B cells were then stimulated with LPS plus IL-4 for 96 hours before analysis of GFP⁺ and/or IgG1⁺ B cells by flow cytometry. Dead (7-AAD⁺) cells were excluded from analysis.

Gan H., Shen T., Chupp D.P., Taylor J.R., Sanchez H.N., Li X., Xu Z., Zan H, & Casali P. (2020). B cell Sirt1 deacetylates histone and non-histone proteins for epigenetic modulation of AID expression and the antibody response. Science Advances, 6(14), eaay2793.

+ Open protocol

+ Expand

Overexpression of Rad52 in Mouse B Cells

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rad52 cDNA was amplified from mouse B cells using the appropriate primers (Supplementary Table 2) and cloned into the pMIG retroviral expression vector (green fluorescent protein (GFP) translation initiated by the internal ribosome entry sites (IRES) in transduced B cells). To generate the retrovirus, pMIG vector encoding GFP or pMIG-Rad52 construct encoding GFP and Rad52, together with the pCL-Eco retrovirus-packaging vector (Imgenex), were used to transfect HEK293T cells by a Ca⁺⁺ phosphate-mediated transfection procedure (ProFection Mammalian Transfection System, Promega). Viral supernatants were collected and used to transduce spleen B cells from C57BL/6 mice, as we reported64 (link)65 (link), after a 12 h LPS activation. Transduced B cells were then stimulated with LPS plus IL-4 for 96 h before analysis of GFP⁺ and IgG1⁺ B cells by flow cytometry64 (link)65 (link)—dead (7-AAD⁺) cells were excluded from analysis. Expression of Rad52, Ku86 and β-Actin proteins in B cells transduced with empty or Rad52-expression pMIG retroviral construct were analysed by immunoblotting66 (link).

Zan H., Tat C., Qiu Z., Taylor J.R., Guerrero J.A., Shen T, & Casali P. (2017). Rad52 competes with Ku70/Ku86 for binding to S-region DSB ends to modulate antibody class-switch DNA recombination. Nature Communications, 8, 14244.

+ Open protocol

+ Expand

Retroviral Knockdown and Overexpression in HPC7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For knockdown experiments, shRNA fragments were cloned into pMSCV/LTRmiR30-PIG (pLMP, Open Biosystems): Luciferase (control, 5’ CACGTACGCGGAATACTTCGAA 3’, [30 (link)]), Gata2 (5’ CGCCGCCATTACTGTGAATATT 3’, [31 (link)]). For overexpression experiments, the mouse Gfi1 cDNA was inserted into pMSCV-ires-GFP (Addgene plasmid 20672), with the empty vector used as a control. Retrovirus was produced using the pCL-Eco Retrovirus Packaging Vector (Imgenex) in 293T cells.
HPC7 cells were infected with retrovirus by centrifugation at 800 xg at 32°C for 1.5 hours with 4 μg/ml polybrene (Sigma), after which the retroviral supernatant was replaced with fresh media and cells were cultured as normal. Transduction efficiency was monitored by flow cytometry for GFP.

Ezer D., Moignard V., Göttgens B, & Adryan B. (2016). Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data. PLoS Computational Biology, 12(8), e1005072.

+ Open protocol

+ Expand

Characterization of Murine Mast Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine mast cell lines FMP6- and MST have been described (McKinlay et al, 1998 (link)) (Elefanty & Cory, 1992 (link)) and characterised (Bockamp et al, 1998 (link)) previously. Cx3cr1 luciferase reporter constructs were custom-made (Life Technologies), cloned into pGL2basic (Promega) and confirmed by sequencing. Cells were transfected and assayed as previously described (Gottgens et al, 1997 (link)).
shRNA fragments were inserted into pMSCV/LTRmiR30-PIG: luciferase (5′ CACGTACGCGGAATACTTCGAA 3′ (Bot et al, 2005 (link))), Erg (5′ ACCTCCCAATATGACCACAAAT 3′), Gata2 (5′ CGCCGCCATTACTGTGAATATT 3′ (Huang et al, 2009 (link))), Fli1 (5′ ACCAGTGAGAGTCAATGTCAAG 3′), Pu.1 (5′ AGGATGTGCTTCCCTTATCAAA 3′) and Lmo2 (5′ CCCAGCCCTTAGAGAGAATTTA 3′). Retrovirus was produced using the pCL-Eco Retrovirus Packaging Vector (Imgenex). BMMCs were infected with retrovirus by centrifugation at 2200rpm at 32°C for 1.5 hours with 4μg/ml polybrene (Sigma-Aldrich) after which the retroviral supernatant was replaced with fresh media. After 48 hours, GFP⁺ transduced cells were sorted and cultured further for 24h before RNA extraction. Knock-down efficiency is shown in Figure E8A.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!