Quantitect sybr green rt qpcr kit

Total RNA was extracted from tissues and HaCaT cells using Trizol reagent (Invitrogen), and then RNA was reversely transcribed into complementary DNA with Transcriptor First Strand cDNA Synthesis Kit (Roche, Indianapolis, IN, USA). Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) was performed with the QuantiTect SYBR Green RT‐qPCR Kit (Qiagen, Hilden, Germany) on Applied Biosystems 7300 Fast Dx RealTime PCR Detection System (Thermo Fisher Scientific). The comparative Ct method was used to quantify target gene (IL‐8, IL‐6, and TNF‐α) expression. The relative mRNA expression of IL‐8, IL‐6, and TNF‐α was normalized to β‐actin (internal control) using the 2^−ΔΔCt method.³⁸ ΔΔCt = (Ct_{target gene—}Ct_{internal control}) _{experimental group}—(Ct_{target gene}—Ct_{internal control}) _{normal control group}.

Total RNA was extracted from cells using a RNeasy Plus RNA extraction kit (Qiagen, 74136) according to the manufacturer’s protocol. RT-qPCR reactions were run using a QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotorgene Q. Relative copy number of transcripts was determined from a standard curve and then normalised by the expression of RPLP0 control gene. Primer pairs are listed in Supplementary Table 5.

Total RNA was isolated using the Qiagen RNeasy Mini Kit (Qiagen, Hilden, Germany; DUS cohort) and NucleoSpin® RNA Kit (Macherey-Nagel GmbH, Dueren, Germany; BN cohort) according to the manufacturers’ protocols. RNA of non-epithelial control cells was kindly provided by Dr. C. Münk, (Heinrich Heine University Duesseldorf). For the DUS cohort, cDNA synthesis was performed with the QuantiTect Reverse Transcription Kit (Qiagen) with an extended incubation time of 30 min at 42 °C. For the BN cohort cDNA synthesis was performed using the SuperScript™ III First-Strand Synthesis System (Thermo Fisher Scientific, Waltham, MA, USA). QuantiTect SYBR Green RT-qPCR Kit (Qiagen) was used for RT-qPCR. Primer sequences for target genes and reference genes are listed in Additional file 1: Table S1. TBP (TATA-box binding protein) and SDHA (Succinate Dehydrogenase Complex Flavoprotein Subunit A) were measured as reference genes and a normalization factor was calculated for each sample using their geometric mean [21 (link)]. RT-qPCRs were run on the LightCycler 96 PCR platform (Roche, Penzberg, Germany).

Retinas were harvested 4 weeks post-injection and total RNA extracted as described^{35 (link)–37 (link)}. In vivo expression levels of EGFP were determined by reverse transcription PCR (RT-qPCR) on a StepOne Real Time PCR System (Applied Biosystems, Foster City, CA, USA) using a one step QuantiTect SYBR Green RT-qPCR kit (Qiagen Ltd., Crawley, UK) and the following primer pair: 5′ TTCAAGAGGACGGCAACATCC 3′ and 5′ CACCTTGATGCCGTTCTTTCGC 3′. RT-qPCRs were performed twice in triplicate. Expression levels were normalised using the internal housekeeping gene β-actin (Actb) and the following primer pair: 5′ AGAGCAAGAGAGGCATCC 3′ and 5′ TCATTGTAGAAGGTGTGGTGC 3′. Standard curves of Actb were generated by serially diluting retinal RNA 5×. Standard curves of EGFP were generated by serially diluting plasmid DNA containing an EGFP gene 10×. A minimum of 4 points were used in all standard curves.

Total RNA was isolated from cells using the RNeasy mini kit (Qiagen). RT-qPCR was performed on an Applied Biosystems 7300 machine using the QuantiTect SYBR Green RT-qPCR Kit (Qiagen). Primers specific to PV, DENV, or ZIKV were used (see S2 Table).

Cellular nucleic acids from cultures in 6-well plates were extracted using the RNeasy Mini kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol. qPCR analysis of cellular mRNA expression using Maxima Probe qPCR Master Mix including ROX dye (ThermoFisher Scientific, Dreieich, Germany), a StepOnePlus (Applied Biosystems, Foster City, CA, USA) quantitative PCR machine, and plasmid standard curves was performed as previously described [48 (link)]. Primers, Taqman probes, and cycling conditions are summarized in Table A1. Cellular nucleic acids from cultures in 96-well plates were extracted using NucleoSpin^® RNA Plus Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol. Relative expression levels of ISG54 and RPL13A were determined using QuantiTect SYBR Green RT-qPCR Kit (QIAGEN) with the respective specific primers on a LightCycler^® 480 Instrument (Roche, Basel, Switzerland). Relative mRNA expression levels were normalized to the housekeeping gene RPL13A and analyzed using the 2^(−∆∆CT) method, finally depicted as fold inductions over mock A, mock B, or medium, as indicated. Primers and cycling conditions are summarized in Table A2. Primer efficiencies have been tested before in 10-fold serial dilutions and were calculated to have >90% efficiency.