Cut run assay kit

The ChIP‑qPCR assay was conducted with a CUT&Run Assay Kit following the procedure (Vazyme, China) according to the manufacturer's instructions. Similarly with CUT&Tag assay, 1×10⁶ HK-2 cells were collected, and their nuclei were isolated and purified with activated conA beads and incubated with an anti-TFEB antibody or a rabbit IgG (internal control control) overnight at 4 °C. Nuclei were incubated with pG-MNase Enzyme for 1 h at 4 °C the next day. Then CaCl₂ was added and incubated for 90 minutes at 0 °C to promote MNase digestion. The fragments were stopped by adding Stop Buffer and were washed with ethanol, and DNA was resuspended with double-distilled water. Subsequently, qPCR was performed to detect target genes. Primers for CUT&Run-qPCR were as follows: ATP6V0C-A-F: GGAAGAATGAGGGCGTCTGA, ATP6V0C-A-R: CAAGTGGACCTCTGTGCTGC; ATP6V0C-B-F: CTTCTCAGAAACAAGGGCCG, ATP6V0C-B-R: GGTTCAAAGGAGAGGAGGCAA; ATP6V0C-C-F: CTGAAGGTGCAGGCTTTGC, ATP6V0C-C-R: TGTCTCTGCCCCTCAAGATG and ATP6V0C-D-F: AGGCAGTAGGTCTGGGTCTG; ATP6V0C-D-R: CACAGCGTCCGGAAAAGC.

To investigate the binding of HIF-1α to the promoter region of ZEB1, we employed the CUT&RUN technique. The CUT&RUN assay was conducted using the CUT & RUN Assay Kit (HD101-01, Vazyme, China) according to the manufacturer's instructions [17 (link)]. Cells were treated with various conditioned media for 48 h. After centrifugation and resuspension, 1 × 10⁵ cells per sample were utilized for the experiments. Briefly, cells were incubated with pre-treated ConA Beads Pro for 10 min, followed by immunoprecipitation with the corresponding primary antibody for 2 h at room temperature. Subsequently, pG-MNase, bound to the cells, was activated by CaCl₂. Following a 30-min abortive termination step of the reaction system at 37 °C, the reaction system was centrifuged to collect the supernatant containing chromatin-rich products. An equal number of cells were employed in each group, and 10 pg spikes were added to each sample for calibration. The data were presented as 2 − ^△△CT values, normalized to the control group. For specific primers used in the analysis, please refer to Additional file 1: Table S1.