Three hundred thousand Hela cells were plated on 6-well-plate and incubated for 24 hour with Hela media. After the incubation, the media was removed and replaced with DMEM media containing 8μg/ml polybrene. Lentiviral particles of pLenti/IL-12/FasTI, pLenti/IL-12 and pLenti/Fas (Lent-IF, Lent-IL12, Lent-Fas) were added in plating media by1:10 dilution, and incubated for another 48 hour for transient transduction. Total RNA was extracted from each clone using an RNeasy Plus Mini kit following the manufacturer’s directions. RT-PCR was run with 2μg of the total RNA using Phusion RT-PCR kit following the manufacturer’s instruction (Thermo Fisher). To amplify a 1059-bp segment of IL-12/FasTI containing 522-bp of the mIL-12, the linker (GGTGGTGGTTCTGGTGGTGGTTCTGGTGGTGGTTCT ), and the entire 495-bp of FasTI, a 5’ primer GCAGTGACATGTGGAATGGC and a 3’ primer CGGAATTCTCACTC CAGACATTGTCCTTCATTTTC were used. To amplify 180-bp portion of IL-12, a 5’ primer GGAAGCACGGCAGCAGAATA and a 3’ primer AACTTGAGGGAGAAGTAGGAATGG were used. To amplify 984-bp of Fas sequence, a 5’ primer ACCATGGTGTGGATCTGG and a 3’ primer CTCCAGACATTGTCCTTCATTTTC were used. All RT-PCR reactions included the β-actin housekeeping gene as loading control using a 5’primer ATGGGTCAGAAGGATTCCTATGTG and a 3’ primer CTTCATGAGGTAGTCAGTCAGGTC amplifying a 488-bp fragment.
Phusion rt pcr kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Phusion RT-PCR kit is a reagent kit designed for reverse transcription and real-time PCR amplification. The kit contains all the necessary components for the conversion of RNA to cDNA and subsequent real-time quantitative PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Nucleospin rnaii, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Spectrum plant total rna kit, by Merck Group (2 mentions)
On column dnase 1 digestion kit, by Merck Group (2 mentions)
Iscript select cdna synthesis kit, by Bio-Rad (1 mentions)
Dnase, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
Exosap it, by GE Healthcare (1 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity pcr kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Promega (1 mentions)
Optima l 100 xp, by Beckman Coulter (1 mentions)
C100 touch thermocycler, by Bio-Rad (1 mentions)
C1000 touch thermocycler, by Bio-Rad (1 mentions)
Rnaeasy mini kit, by Qiagen (1 mentions)
Hek293, by American Type Culture Collection (1 mentions)
Lipofectamine, by Thermo Fisher Scientific (1 mentions)
Top10 cells, by Thermo Fisher Scientific (1 mentions)
12 protocols using phusion rt pcr kit
1
Lentiviral Transduction and RT-PCR Analysis
2
Embryonic Transcriptome Analysis via RT-PCR
3
C-to-U RNA Editing in A. kona
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C-to-U type RNA editing sites in A. kona mtDNA were predicted using PREPACT (Lenz and Knoop 2013 (link)) (last accessed May 15, 2014). The probability of each candidate editing site was calculated by the percentage of the overlapping predictions against all the references from the output “commons.” Multiple alignment of the gene sequences containing the candidate sites was further checked. Oligonucleotide primer pairs were designed to flank the coding regions of four A. kona mitochondrial genes (nad1, atp6, cob, and cox3) with strong candidate sites (supplementary table S1 , Supplementary Material online). For cDNA synthesis, total RNA was extracted and treated with DNase (Thermo). First strand cDNA was synthesized using the Phusion RT-PCR Kit (Thermo) with hexanucleotide random primer mix. PCR amplification of both mitochondrial genomic sequence and cDNA products was performed using the Phusion High-Fidelity DNA Polymerase (Thermo). PCR amplicons were cleaned with ExoSap-IT (GE Healthcare) and sent for direct sequencing.
4
Quantifying Mitochondrial Translocase Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Life technologies). RT-PCR was performed with the Phusion RT-PCR kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Primers (Sigma-Aldrich, St. Louis, MO, USA) were designed using Primer 384 (link), and were identical to those used by Le Bras et al.85 (link). The primers were the following: hANT1-F: ATGGGTGATCACGCTTGGAGCTTCCTAAAG and hANT1-R: TTAGACATATTTTTTGATCTCATCATACAA, hANT2-F: cagcagtctgcctcctcttt and hANT2-R: aagctttgcctccttcatca.
5
Cell Viability on 3D Polycaprolactone Scaffolds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hWJMSCs at a density 3 × 105 cell/mL were seeded onto the PCL scaffolds and maintained for 1, 3, or 5 days under standard conditions. The number and viability of attached cells from each sample were evaluated indirectly from the total cDNA. To perform the assay, the total RNA was extracted from the 1-, 3-, and 5-d cultured cells on the 2D and 3D PCL scaffolds, using an RNA extraction kit (NucleoSpin® RNAII, Fisher Scientific, Dublin, Ireland). The cDNA was synthesized from mRNA via a reverse-transcriptase reaction, using a Phusion® RT-PCR kit (Thermo Scientific, Waltham, MA, USA). The cDNA solution was read at an absorbance of 280 nm, using a NanoDrop®1000 (Thermo Scientific, Waltham, MA, USA). The absorbance values were then converted to total cDNA concentrations and were represented as percent relative cell viability (% RV), compared with the PS. Each sample was set up in five replicates. The protocol diagram is provided in Figure 2 b.
6
Evaluating Stem Cell Markers in 3D Membrane Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BCP-K1 was cultured on PS, PLCL-2.5SC, and PLCL-5SC membranes for 24 and 120 hours before RNA extraction (NucleoSpin RNA II, Fisher Scientific, Ireland). Total mRNA was reverse-transcribed to cDNA, using a Phusion RT-PCR kit (Thermo Scientific, USA). Then, 500 ng of cDNA was used as template, to amplify different genes using the primers listed in Table 1 . Two gene groups were evaluated in this study: (1) pluripotency-related genes, POU5F1 and SSEA-4, and (2) differentiation-related genes, nestin, COL2A1, and PPARγ2. Semiquantitative PCR was performed by using Phusion High-Fidelity PCR Kit (Thermo Scientific, USA) with subsequent thermocycler setting: denaturation at 95°C, annealing from 53 to 65°C (depending on the melting temperature of the primers), and extension at 72°C. The PCR products were detected using 1% (w/v) agarose gel electrophoresis and imaged under the UV-transilluminator. Band intensity was analyzed, using Quantity One V.4.4.1 (Bio-Rad Laboratories, Hercules, CA, USA). Expression of each gene was evaluated and normalized with the housekeeping gene, GAPDH. For each cell culture condition, three independent samples were analyzed.
7
Recombinant Baculovirus-Mediated HCV Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Sf9 cells were infected with the bv-CE1E2mut recombinant baculoviruses (5 CFU per cell) and incubated at 27 °C for 72 h. After 72 h, the medium was eliminated and cell debris was removed by low-speed centrifugation. The supernatant was centrifuged through the 30% sucrose cushion at 23000g for 16 h at 4 °C (Beckman Coulter Optima L-100XP centrifuge, 80Ti rotor). RNA was extracted from the pellet with TRIzol (Invitrogen) according to manufacturer's protocol and treated with DNase I (Promega). Reverse transcription was carried out using the Phusion RT-PCR Kit (Thermo Scientific). The obtained cDNA was amplified using PCR with primers for the genes of structural and nonstructural HCV proteins. Total cellular RNA was extracted from Sf9 cells infected with bv-CE1E2mut or bv-CE1mut E2 (5 CFU per cell) that were incubated at 27 °C for 72 h and washed three times with PBS. RNA isolation, reverse transcription, and amplification were performed using the above-mentioned protocols. The Hek293T cells were transfected with the BacMamCE1E2mut-GFP recombinant plasmids or the BacMamCE1mut E2-GFP (5 CFU per cell) and incubated at 37 °C for 48 h. The medium was removed and RNA isolation, reverse transcription, and amplification were performed using the above-mentioned protocols.
8
In Situ Hybridization of Abhd2 in Murine Ovary
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lateral CP slices, isolated as described above, were used for ISH. RNA was extracted from the murine ovary using a Qiagen RNAeasy mini kit followed by cDNA synthesis with a Phusion RT-PCR kit (Finnzymes). The specific translated region of Abhd2 was amplified using the following primers: (forward, 5′-GTCGGATGGTGCCACTTC-3′; reverse, 5′-CCTCCATCTGCTCCGTGT-3′) and subcloned into a vector containing Sp6/T7 promoters (Promega). Single-strand digoxigenin-labeled RNA probes were synthesized (Roche), and color ISH was performed as in Ishii et al. (2004) (link). A sense probe was used as a negative control.
9
RNA Extraction and RT-qPCR Analysis of Wheat Leaves
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from frozen, ground wheat leaf tissue using a Spectrum Plant Total RNA Kit (Sigma‐Aldrich) and On‐column DNase I Digestion Kit (Sigma‐Aldrich) for genomic DNA removal. cDNA was synthesized using a reverse transcriptase kit (Phusion RT‐PCR Kit; Finnzymes) and Q‐PCR undertaken using a CFX96 real time system and C100 touch thermocycler (Bio‐Rad). Target gene sequences were normalized relative to the wheat glyceraldehyde‐3‐phosphate dehydrogenase gene (GAPDH) using the comparative CT method (Schmittgen and Livak, 2008 ) or alternatively target sequence concentration was determined using a standard curve derived from a target fragment linear dilution series, followed by normalization relative to GAPDH (Rinaldo et al., 2015 ). Three replicate reactions were undertaken per RNA sample. Primer sequences used for amplification are shown in Table S1. Melting curves for primer pairs used in Q‐PCR analyses are shown in Figure S8.
10
Quantifying Wheat Leaf Lr34 Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA for quantitative PCR analysis was extracted from wheat flag leaves of plants grown in the field. A Spectrum Plant Total RNA Kit (Sigma-Aldrich) was used for RNA extraction and On-column DNase I Digestion Kit used to remove genomic DNA (Sigma-Aldrich). cDNA was produced by reverse transcription using a Phusion RT-PCR kit (Finnzymes) and qPCR undertaken using a CFX96 Real Time System and C1000 Touch Thermo Cycler (Bio‐Rad). Lr34 transcripts were normalized relative to the wheat glyceraldehyde 3-phosphate dehydrogenase gene (TaGAPDH; GenBank AF251217) using the comparative CT method (Schmittgen and Livak 2008 (link)). Primer sequences are shown in Table S1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!