The human TFAP4 gene was PCR-amplified from cDNA and cloned into a pSin-EF2 lentiviral vector. To silence TFAP4, two human TFAP4-targeting short hairpin RNA (shRNA) sequences were cloned into a SUPER.retro.puro vector (OligoEngine, Washington, USA) to generate the respective pSUPER.retro.TFAP4-RNAi(s). HepG2 or LM3 cells were plated at 2×106 cells per p100 plate and transfected with 10 µg of the indicated plasmids. Stable cell lines expressing TFAP4 or TFAP4 shRNA were generated via retroviral infection using HEK293T cells as previously described 30 (link). The stable cell lines were selected for 10 days with 0.5 mg/mL puromycin. The human DVL1 promoter region spanning nucleotides -348 to -193 and the human LEF1 promoter region spanning nucleotides -321 to -173 (relative to the transcription initiation site) generated by PCR-amplification from HepG2 cells were cloned, respectively, into the NheI/BglII sites of pGL3-basic luciferase reporter plasmid (Promega, Madison, WI, USA) to generate DVL1 and LEF1 luciferase reporters. The primers are listed in the Supplemental Methods section on Plasmids, Retroviral Infection and Transfection.
Super retro puro vector
Manufactured by Oligoengine
Sourced in United States
The SUPER.retro.puro vector is a laboratory equipment designed for genetic engineering applications. It functions as a plasmid vector for the insertion and expression of foreign DNA sequences in host cells.
Automatically generated - may contain errors
3 protocols using super retro puro vector
1
Lentiviral Overexpression and Knockdown of TFAP4
2
Silencing TRIP6 in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human TRIP6 gene was PCR-amplified from cDNA and cloned into a pSin-EF2 lentiviral vector. To silence TRIP6, a TRIP6-targeting short hairpin RNA (shRNA) sequence was cloned into a SUPER.retro.puro vector (OligoEngine, Washington, USA) to generate the respective pSUPER.retro.TRIP6-RNAi(s). The targeting sequence is 5′-GAAGCTGGTTCACGACATGAA-3′ [13 (link)]. Retroviral production and infection were performed as previously described [14 (link)]. Stable cell lines expressing TRIP6 or TRIP6 shRNAs were selected for 10 days with 0.5 μg/ml puromycin. The TOP Flash and FOP Flash reporters containing the wild-type and mutated TCF/LEF DNA-binding sites, respectively, were purchased from Upstate Biotechnology (Lake Placid, NY, USA). Transfection of siRNAs (Ribo Biotech, Guangzhou) or psin-EF2-TRIP6 and pSUPER. retro. TRIP6-RNAi plasmids (5 μg) were performed using the Lipofectamine 2000 reagent (Cat#11668019, Invitrogen, Carlsbad, CA, USA).
3
Genetic Manipulation of GOLPH3 in NSCLC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human GOLPH3 cDNA was amplified by PCR and cloned into the pMSCV-puro vector. The primer sequences used for this analysis are listed in Supplemental Table 2 . Two human GOLPH3-targeting short hairpin RNA (shRNA) sequences (shRNA#1: GCATGTTAAGGAAACTCAGCC; shRNA#2: GCAGCGCCTCATCAAGAAAGT) were cloned into a SUPER.retro.puro vector (OligoEngine, Seattle, WA, USA) to knockdown GOLPH3 expression. CKAP4-siRNA (5′-TCAGCGAAGTGCTGCAGAA-3′) was purchased from Ruibo Biotechnologies (Guangzhou, China). Stable NSCLC cell lines were generated by retroviral infection and selected for 10 days using 0.5 μg/ml puromycin (Solarbio, Beijing, China. Cat. No. P8230), as described previously [9 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!