RNA was isolated from excised tumors after generation of single‐cell suspensions using an RNA isolation kit (Bio & Sell, Germany) according to the supplier's protocol. The RNA concentration of each sample was determined using fluorescent RNA labeling (Quant‐it RiboGreen RNA Reagent; Thermo Fisher, Germany) and a fluorometer (DS‐11 FX; DeNovix, Germany). Absolute concentrations were calculated against a standard curve. Subsequent gene expression analysis was performed using the NanoString nCounter technology, which directly evaluates RNA levels without prior complementary DNA synthesis. Briefly, 50 ng RNA per sample was hybridized for 24 h at 65 °C with reporter and capture ProbeSets of the nCounter PanCancer IO 360 Panel targeting 770 genes specifically designed for research in immuno‐oncology. Immediately after, samples were loaded into the nCounter SPRINT cartridge and processed by the NanoString nCounter system. Differential gene expression analysis was performed using the nSolver 4.0 analysis software (all NanoString Technologies, USA). Pathway enrichment analysis was evaluated using GSEA Software[89 , 90 ] and processed with Cytoscape.[91 ] Cell fractions were quantified from bulk tissue gene expression profiles using CIBERSORTx.[92 ]
Rna isolation kit
Manufactured by Bio&Sell
Sourced in Germany
The RNA isolation kit is a laboratory tool designed to extract and purify ribonucleic acid (RNA) from various biological samples, such as cells, tissues, or body fluids. The kit provides a standardized and efficient method for isolating high-quality RNA for downstream applications, including gene expression analysis, reverse transcription, and other RNA-based techniques.
Automatically generated - may contain errors
Lab products found in correlation
Kicqstart sybr green primers, by Merck Group (2 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Quant it ribogreen rna reagent, by Thermo Fisher Scientific (1 mentions)
Nsolver 4.0 analysis software, by NanoString (1 mentions)
Ds 11 fx, by DeNovix (1 mentions)
Primescript cdna synthesis kit, by Takara Bio (1 mentions)
Quantstudio 1, by Thermo Fisher Scientific (1 mentions)
4 protocols using rna isolation kit
1
Profiling Tumor Immune Landscape
2
Quantification of SLC22 Family mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following esiRNA knockdown, total mRNA was isolated using RNA isolation kit (BioSell GmbH). In all, 1 µg of mRNA was converted to complementary DNA (cDNA) using High-Capacity cDNA Reverse Transcription Kit (Thermo Scientific). Predesigned KiCqStart™ SYBR green primers for human beta actin, SLC22A16, SLC22A2, and SLC22A3 were obtained from Sigma-Aldrich. Quantitative PCR assays were carried out using Power SYBR™ Green PCR Master Mix (Thermo Fisher) according to manufacturer’s instructions.
3
Quantifying gene expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated using a RNA isolation kit (BioSell GmbH). One microgram of mRNA was converted to cDNA using the PrimeScript cDNA synthesis kit (Takara Bio). Predesigned KiCqStart SYBR Green primers for human β-actin (Fwd: GATGGGCGGCGGAAAATAG Rev: GCGTGGATTCTGCATAATGGT) and SLC7A11 (Fwd: CCTCTATTCGGACCCATTTAGT Rev: CTGGGTTTCTTGTCCCATATAA) were obtained from Sigma-Aldrich. qPCR assays were carried out using Power SYBR Green PCR Master Mix in a Quantstudio 1 device (ThermoFisher) with 40 cycles of PCR amplification using 95 °C for 30s, 95 °C for 5s, and 60 °C for 30s for each cycle. The ΔΔCt method was employed to calculate fold changes in gene expression using the Quantstudio design and analysis software.
4
Endothelial RNA Isolation from ApoE-/- Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal procedures were approved by the local government authority Regierungspräsidium Darmstadt. For high-fat diet male ApoE−/− mice (C57BL/6 background) were purchased from Taconis M&B A/S (Ry, Denmark, strain B6.129P2-Apoetm1Unc N6) and bred at the local facility. Paigen-type (19.6% protein, 15.8% fat, 4.3% fiber, 5% ash, 24.4% starch, 7.9% sugar; 1.25% cholesterol, 0.5% Cholate) diet was purchased from Ssniff Spezialdiäten (Soest, Germany). Animals received paigen-type diet ad libitum for 1 or 4 days. After diet feeding, endothelial-specific RNA of carotid arteries were isolated29 (link).
For ex vivo oxPAPC treatment C57BL/6J mice were euthanized with isoflurane. Mice were coated with 70% ethanol to decontaminate the incision area and then perfused with cold HANKS solution. The thoracic aorta was detached from the thoracic vertebrae and cleaned from adipose tissue. Vessels were cut into 1 mm segments and incubated in EBM 1% FCS (endothelial basal medium + 1% fetal calf serum). Each vessel was split into 12 × 1 mm segments, after which four segments were used for each treatment group. All vessels were incubated overnight in EBM + 1% FCS and treated the following day. RNA was isolated according to the manufacturer instructions (Bio&Sell RNA Isolation Kit).
For ex vivo oxPAPC treatment C57BL/6J mice were euthanized with isoflurane. Mice were coated with 70% ethanol to decontaminate the incision area and then perfused with cold HANKS solution. The thoracic aorta was detached from the thoracic vertebrae and cleaned from adipose tissue. Vessels were cut into 1 mm segments and incubated in EBM 1% FCS (endothelial basal medium + 1% fetal calf serum). Each vessel was split into 12 × 1 mm segments, after which four segments were used for each treatment group. All vessels were incubated overnight in EBM + 1% FCS and treated the following day. RNA was isolated according to the manufacturer instructions (Bio&Sell RNA Isolation Kit).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!