Primescript rt master mix kit

Total RNAs were isolated from myocardial tissue samples of rats using TRIzol reagent according to the manufacturer's instruction (Invitrogen, USA). After being isolated, the RNA was reverse-transcribed to cDNA with the use of a 5x PrimeScript® RT Master Mix Kit (TaKaRa, Dalian, China). For the reverse transcription, the following protocol was used: 2 μl RT Master Mix, 500 ng total RNA, and RNase-free dH₂O up to 10 μl (a reaction volume of 10 μl is the highest value to accommodate 500 ng RNA samples according to the manufacturer's instructions). The mass of total RNA was detected by Ultraviolet Spectrophotometer (Thermo Fisher Scientific, MA, USA). The reverse transcription reaction consisted of 15 minutes of reaction: 37°C for 15 minutes and 85°C for 5 seconds using the iCycle system (Bio-Rad, CA, USA).

Total RNA was isolated from mDCs with RNAiso Plus reagent and the 5X PrimeScript™ RT Master Mix kit (all from TaKaRa, Shiga, Kusatsu, Japan) was used for converting 1 μg of total RNA to the first‐strand cDNA following the manufacturer's instructions. The quantitative PCR of IL‐10 (sense primers, 5′‐GACTTTAAGGGTTACCTGGGTTG‐3′, and reverse primer, 5′‐TCACATGCGCCTTGATGTCTG‐3′) were performed using the FastStart Universal SYBR Green Master kit (Roche, Mannheim, Germany). β‐Actin (sense primers, 5′‐AGAGCTACGAGCTGCCTGAC‐3′, and reverse primer, 5′‐ AGCACTGTGTTGGCGTACAG‐3′) was used as an endogenous reference. The PCR was performed as 10 min initial denaturation at 95°C, 40 cycles consisted of 10 s at 95°C and 30 s at 60°C carried out on the CFX96™ Real‐Time PCR cycler (Bio‐Rad, Hercules, CA, USA). The expressions of the target genes were expressed as fold increase relative to the expression of β‐actin. The mean value of the replicates for each sample was calculated and expressed as cycle threshold (CT). The amount of gene expression was then calculated as the difference (ΔCT) between the Ct value of the target genes and the Ct value of β‐actin. Fold changes in target genes mRNA were determined as 2^−ΔCT.

Total RNA was extracted from GC cells or tissues using TRIzol Reagent (Invitrogen, 15,596,018). RNase R treatment was carried out for 15 min at 37 °C using 3 U/mg RNase R (Epicenter). For Quantitative real-time PCR (RT-PCR), 500 ng of treated RNA was directly reverse transcribed using Prime Script RT Master Mix (Takara, Japan) and either random or oligo(dT) primers. Reverse transcription of miRNA was performed using a New Poly(A) Tailing Kit (ThermoFisher Scientific, China). mRNA was reverse transcribed into cDNA with a PrimeScript RT Master Mix Kit (Takara, RR036A, Japan). cDNA was amplified using Universal SYBR Green Master Mix (4,913,914,001, Roche, Shanghai, China). The CT value was measured during the exponential growth phase. Relative gene expression levels were determined using the 2^-△△CT method. The primers used are listed in Additional file 1: Table S2.

In this study, an Applied Biosystems QuantStudio 3 real-time fluorescence quantitative PCR system was used to reverse transcribe the extracted total RNA into cDNA according to the instructions of a PrimeScript™ RT Master Mix Kit (RR036A, TAKARA). Then, based on the cDNA sequences of the goat PDGFRA, WNT5A, BMPR2, and BMPR1A genes published by NCBI, specific primers were designed with Primer 5.0 (Table 3) and synthesized by Shanghai Bioengineering Co., Ltd. Finally, a TB Green “Premix Ex Taq” II Kit (RR820A, TAKARA) was used for qRT–PCR. Six samples were tested for each month, and three technical replicates were performed.

Total RNA was extracted using an RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany) and was reverse‐transcribed using a PrimeScript RT Master Mix kit (TaKaRa, Dalian, China) for standard real‐time PCR analysis. RT/qPCR was performed using a TB Green Premix EX Taq II detection system in a Roche LightCycler 96 qPCR machine (Roche Diagnostics, Mannheim, Germany). Glyceraldehyde 3‐phosphate dehydrogenase was used as a control. The gene‐specific primers are summarized in Table S1.