Human 293Ts prepared for transfection as described above. Lentivirus was prepared for individual sgRNAs and plasmids by co-transfecting 293Ts with 1.06ug pMDLG (Addgene #12251), 0.57 pMD2G (Addgene #12259), 0.4ug pRSV-Rev (Addgene #12253), 1.06ug plasmid to be packaged, and a 1:3 ratio of total DNA to PEI into individual wells of a 6-well plate. Supernatant was collected 48hrs later, filtered through 0.45μm filter, and stored at -80 until use. Lentivirus was then thawed on ice before used for transduction. Lentivirus prepared for pooled libraries was scaled up by co-transfecting 293Ts seeded on 0.1% gelatin coated 15cm plates with 13.25ug pMDLG, 7.2ug pMD2G, 5ug pRSV-Rev, 20ug of pooled Brunello library (Addgene #73178) and 136ul PEI per 15cm plate. Supernatant was collected and replaced with DMEM + 10% FBS and 1% NEAA at 24hrs, and collected a final time at 48hrs post transfection. Supernatant was filtered, aliquoted, and stored at -80C until use.
Prsv rev
Manufactured by Addgene
Sourced in United States, Japan, United Kingdom, Germany, Morocco, Singapore
The PRSV-Rev is a laboratory product available from Addgene. It is a plasmid construct that contains the Rev gene from the Simian immunodeficiency virus (SIV). This product is intended for research use only.
Automatically generated - may contain errors
Lab products found in correlation
Pmdlg prre, by Addgene (259 mentions)
Pmd2 g, by Addgene (184 mentions)
Pcmv vsv g, by Addgene (68 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (39 mentions)
Polybrene, by Merck Group (37 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (34 mentions)
Lenti x concentrator, by Takara Bio (18 mentions)
Puromycin, by Merck Group (15 mentions)
Opti mem, by Thermo Fisher Scientific (13 mentions)
Pvsv g, by Addgene (12 mentions)
Pmdlg rre, by Addgene (11 mentions)
Puromycin, by Thermo Fisher Scientific (10 mentions)
Plko 1, by Addgene (9 mentions)
Lenti x 293t cells, by Takara Bio (9 mentions)
Pmd2 g vsvg, by Addgene (8 mentions)
Pmdlg, by Addgene (8 mentions)
Phiv luc zsgreen, by Addgene (8 mentions)
Effectene transfection reagent, by Qiagen (7 mentions)
Pmd2 vsv g, by Addgene (7 mentions)
Peg it, by System Biosciences (7 mentions)
342 protocols using prsv rev
1
Efficient Lentivirus Production for CRISPR Libraries
2
Murine Kinome CRISPR Library Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pooled-sgRNA library (Mouse Brie kinome pooled library) targeting murine kinome was a gift from John Doench and David Root [18 (link)] (RRID: Addgene_75316, Addgene, Cambridge, MA, USA) and modified for the inclusion of pancreatic cancer-related genes by our lab (supplemental data). The resulting library contained 3548 sgRNAs for 924 murine genes. The lentivirus was produced as described previously [19 (link)]. Briefly, three T175 flasks of HEK293TN cells were plated at 70% confluence and incubated overnight. For each flask, 13.8 μg of pooled-sgRNA library, 9.2 μg of pMDLg/pRRE (Cat# 12251, Addgene), 4.6 μg of pRSV-REV (Cat# 12253, Addgene), 4.6 μg of pMD2.G (Cat# 12259, Addgene), 64.4 μL P3000 Enhancer Reagent, and 129 μL of Lipofectamine™ 3000 diluted in OptiMEM (Cat# 31985070, Gibco) were mixed and added to the HEK293TN cells. pMDLg/pRRE (Addgene, RRID: Addgene_12251), pRSV-REV (Addgene, RRID: Addgene_12253), and pMD2.G (Addgene, RRID: Addgene_12259) were gifts from Didier Trono [20 (link)]. The medium was changed 6 h post transfection and the virus was collected by filtering through a 0.45 μm strainer 24 h later.
3
Lentiviral Plasmid Generation for RNA Interference
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the lentivirus plasmid for stable RNA interference, short hairpins were designed using online software (http://rnaidesigner.lifetechnologies.com/rnaiexpress/design.do ). The sequence of the effective shRNAs were provided as follows: shCD36: CCGACGTTAATCTGAAAGGAA, siCEBPA: GCTGGAGCTGACCAGTGACAA; siCEBPD: GCCGACCTCTTCAACAGCAAT; A non-targeting, scramble silencing RNA was used as control (shCtrl). Virus packaging was performed in 293T cells after co-transfection of packaging plasmids (pRRE, pCMV-VSVG, and pRSV-REV, Addgene) using Lipofectamine 3000.
4
Targeted Knockdown of AKT and SETDB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfections with targeted siRNA against AKT were performed using lipofectamine 3000 according to the manufacturer’s instructions. Stable SETDB1 knockdown cells were generated by transducing U87 or U251 cells with the pLKO.1-puro lentiviral vector (Addgene) expressing shRNA. Lentiviral particles were generated by co-transfecting 293 T cells with the lentiviral vector, pMD2.G (VSVG), pMDLg/pRRE, and pRSV-REV (Addgene). Following lentiviral transduction, cells were plated in 96-well plates in the presence of puromycin (2 μg/ml; EMD/Millipore). SETDB1 expression of the puromycin-resistant clones was then analyzed by Western blotting. The sequences are listed in Table 3 .
Knockdown sequence
| Target sequence | |
|---|---|
| si AKT | GGAGGGUUGGCUGCACAAA |
| sh SETDB1 | GGTGATGAGTACTTTGCCA |
5
Overexpression of Arg1 and Arg2 in RAW264.7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length mouse Arg1 and Arg2 cDNA were cloned using RT-PCR and subcloned into the pCDH-MCS lentiviral vector (System Bioscience, Palo Alto, CA). The Arg1, Arg2 and control lentiviruses were produced by transfecting Lenti-X 293 T cells (Clontech, Mountain View, CA) with the pCDH-Arg1, pCDH-Arg2, pCDH-MCS (control), and packaging (pCMV-VSV-G, pMDLg/pRRE, and pRSV-Rev; Addgene) plasmids using Lipofectamine 3000 (Invitrogen). Infectious lentiviruses were harvested 48 h post transfection and then used to infect RAW264.7 cells with 8 μg/ml polybrene (Sigma-Aldrich).
6
Lentiviral-Mediated Knockdown of Cadherin-11
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid pLKO.1 containing short hairpin RNA (shRNA) sequences targeting cadherin-11 was obtained from Sigma-Aldrich together with a scrambled negative control. These plasmids were co-transfected with third generation lentiviral packaging and envelope vectors; pMD2.G, pRSV-Rev, and pMDLg/pRRE (Addgene plasmid #12259, #12253, and #12251, respectively, which were gifts from Didier Trono15 (link)), into HEK-293T cells using PEIpro (VWR) transfection reagent. Lentiviral particles were harvested 48 and 72 h after transfection. The harvested viral supernatant was filtered and stored at −80 °C until use. Five milliliters of viral supernatant were used to transduce hMSCs seeded at 5000 cells/cm2 in a T225 flask and incubated for 48 h. After transduction, positive cells were selected with 2 µg/mL puromycin dihydrochloride (Sigma-Aldrich) in growth media for 7 days and were then used for subsequent experiments.
7
Lentiviral Reporter Construct with COL2A1 Promoter
8
Lentivirus-Mediated Gene Manipulation
9
Lentiviral Particle Production in HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
24 h before transfection, 4 × 106 HEK2937 cells were seeded in a 100 mm culture dish. On the day of transfection, cells were co-transfected with 15 μg of the pLKO.1_GFP (#30323; Addgene) vector containing OXSR1_Sh1, OXSR1_Sh2 or AthmiR, 6.5 μg of the packaging plasmid pMDL-g/prre (#12251; Addgene), 2.5 μg of the packaging plasmid pRSV-Rev (#12253; Addgene), and 3.5 μg of the envelop expressing plasmid pMD2-VSV-G (#12259; Addgene) by the calcium phosphate transfection method. Culture media was changed the following day and cells were cultured for another 24 h. Medium containing lentiviral particles was then collected, debris was cleared by centrifugation at 430g for 5 min, filtered through a 0.45-μm filter, aliquoted, and stored at −80°C.
10
Lentiviral Vector Production and Transduction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmids pMD2.G, encoding vesicular stomatitis virus glycoprotein (Addgene, USA), pMDLg/pRRE encoding Gag-pol (Addgene, USA) and pRSV-REV, encoding Rev (Addgene, USA) and the protocol developed by Tiscornia, et al.62 (link) were used for this study. The lentivirus expression plasmid pSMPUW-IRES-Puro (Cell Biolabs, CA), expressing the gene of interest under an EF-1 promoter, and containing an IRES and puromycin resistance gene following multiple cloning sites, was used for this research. A plasmid containing HPV16 E7 tagged with HA on the 5′ end (pSMPUW-HAE7) was constructed. 293 TT cells were seeded at a density of 2.5 × 106 cells in a T25 tissue culture flask and incubated at 37 °C, 5% CO2 overnight. The lentiviral vectors containing HAE7 or no insert were generated by transfection of 293 TT cells with PEI, equal parts of pMD2.G, pMDLg/pRRE and pRSV-REV, and two-fold of pSMPUW-HAE7 or pSMPUW. Supernatants were harvested 48 h and 72 h post-transfection and combined, filtered through a 0.45 µm filter, then centrifuged at 70,000 × g for 2 h at 20 °C. Viral pellets were resuspended in 50 mM Tris pH 7.5, 140 mM NaCl, 5 mM EDTA, divided into aliquots and frozen at −20 °C until required.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!