Platinum superfi 2 green pcr master mix

Manufactured by Thermo Fisher Scientific

Sourced in United States

The Platinum SuperFi II Green PCR Master Mix is a ready-to-use solution for performing high-fidelity polymerase chain reaction (PCR) amplification. The master mix contains a high-performance DNA polymerase, optimized buffer components, and a green fluorescent dye for real-time detection.

Automatically generated - may contain errors

Lab products found in correlation

Minelute pcr purification kit, by Qiagen (2 mentions) Agpath id one step rt pcr kit, by Thermo Fisher Scientific (1 mentions) Magna pure 24, by Roche (1 mentions) Purelink genomic dna mini kit, by Thermo Fisher Scientific (1 mentions) E coli neb5α, by New England Biolabs (1 mentions) Phusion dna polymerase, by Thermo Fisher Scientific (1 mentions) Peasy blunt vector, by Transgene (1 mentions) Phusion green hot start 2 high fidelity pcr master mix, by Thermo Fisher Scientific (1 mentions) Genejet gel extraction kit, by Thermo Fisher Scientific (1 mentions) Mix2seq kit, by Eurofins (1 mentions) Quick dna miniprep kit, by Zymo Research (1 mentions) Nucleospin rna virus, by Takara Bio (1 mentions) Accuscript pfuultra 2 rt pcr kit, by Agilent Technologies (1 mentions)

9 protocols using platinum superfi 2 green pcr master mix

Quantitative Rabies Virus Genomics

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the SAD B19 viruses, rabies genomes were exacted by NucleoSpin RNA Virus (740956.50, Takara), RT-PCR was performed with AccuScript PfuUltra II RT-PCR Kit (600184, Agilent) and a customized RT-primer including unique molecular identifier (UMI) sequence, named Adaptor_UMI_N15. The UMI-based counting was used for analyzing rabies barcode diversity.
The redundant Adaptor_UMI_N15 primers in cDNA sample were removed using NucleoSpin Gel and PCR Clean-Up kit with the ratio NTI solution 1:4. The 217 bp of MiSeq sample was prepared by PCR with a high-fidelity polymerase (Invitrogen Platinum SuperFi II Green PCR Master Mix, 12-369-010, USA). The PCR was performed as described below: Invitrogen Platinum SuperFi II Green PCR Master Mix: 12.5 µL; i5-anchor_CTAGCGCT_fp_56 (10 µM): 1.25 µL; i7_TTGGACTT_rp (10 µM): 1.25 µL; cDNA of rabies genome: 1 µL (>100 ng/µL); Nuclease-free water (NEB): 9 µL. The cycle conditions were: (1) 98 °C, 30 s; (2) 98 °C, 5 s; (3) 60 °C, 10 s; (4) 72 °C, 3 s; (5) go to step 2–4, 16 times; (6) 72 °C, 5 min.
After running the product on a 3% low melting agarose gel and the target bands (217 bp) were extracted, the samples were cleaned with Unclasping Gel and PCR Clean-Up kit. The purified products were sequenced on MiSeq in MIT BioMicro Center with sequencing primers below:
N2c viruses were sequenced following the same procedures, using the following primers:

Zhang A., Jin L., Yao S., Matsuyama M., van Velthoven C.T., Sullivan H.A., Sun N., Kellis M., Tasic B., Wickersham I, & Chen X. (2024). Rabies virus-based barcoded neuroanatomy resolved by single-cell RNA and in situ sequencing. eLife, 12, RP87866.

+ Open protocol

+ Expand

SARS-CoV-2 Detection in Semen Samples

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Semen specimens were collected in sterile containers by patients, who were given specific collection instructions. Specimens were sent to the laboratory within one hour from collection. When immediate transfer to the laboratory was not possible, samples were refrigerated at 4°C–6°C for up to 12 h from collection. Following the manufacturer's instructions, nucleic acids were extracted from 0.5 ml of semen samples using the MagNA Pure 24 automatic total nucleic acids extraction system (Roche Diagnostics, Rotkreuz, Switzerland), and eluted in 50 μl elution buffer. SARS-CoV-2 RNA was detected by real-time RT-PCR protocols targeting open reading frame (ORF) 1ab of SARS-CoV-2 genome, using AgPath-ID™ One-step RT-PCR Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA).20 (link) All PCR tests were performed in triplicate, and a cycle threshold value less than 40 cycles was defined as a positive test. All semen samples were also tested in triplicate by a qualitative nested PCR protocol targeting ORF 1ab, using Platinum™ SuperFI™ II Green PCR Master Mix (Thermo Fisher Scientific Inc.) to ensure maximum sensitivity.

Pavone C., Giammanco G.M., Cascino A.P., Baiamonte D., Pinelli M., Cangelosi E., Filizzolo C., Sciortino G., Grazia S.D, & Bonura F. (2022). Assessment of SARS-CoV-2 RNA shedding in semen of 36 males with symptomatic, asymptomatic, and convalescent infection during the first and second wave of COVID-19 pandemic in Italy. Asian Journal of Andrology, 24(2), 135-138.

+ Open protocol

+ Expand

Genomic Profiling of HUVEC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HUVEC cell lines from one white donor and seven African American (AA) donors were purchased from several vendors: one white and 5 AA from Lonza (Walkersville, MD, USA); 1 AA from ACGT (Manassas, VA, USA); and 1 AA from PromoCell (Heidelberg, Germany).
All HUVEC cell lines were cultured in EGM-Plus medium with supplements (Lonza Walkersville) at 37° C in a 5% CO₂/95% air cell culture incubator.
DNA was isolated from these 8 cell lines and sequenced to identify their rs7792678 and rs7811849 genotypes. DNA isolation was done using the PureLink^™ Genomic DNA Mini Kit (ThermoFisher). Then, DNA was amplified using the Platinum^™ SuperFi II Green PCR Master Mix (ThermoFisher) and the PCR product sequenced by ACGT Inc. (Wheeling, IL). The primers used for both PCR amplification and sequencing of THSD7A were: tgtgtcaaaacccaaaaggc (forward) and tcccaccatcaactttgggta (reverse).
Total protein and total RNA were isolated from cells cultured in 10-cm plates. The cells from half of one plate were used for protein extraction, and the cells from the other half of the same plate were used for total RNA extraction.

Yang G., Alarcon C., Chanfreau C., Lee N.H., Friedman P., Nutescu E., Tuck M., O’Brien T., Gong L., Klein T.E., Chang K.M., Tsao P.S., Meltzer D.O., Tuteja S, & Perera M.A. (2023). Investigation of genomic and transcriptomic risk factors in clopidogrel response in African Americans. medRxiv.

+ Open protocol

+ Expand

Engineered Phenylalanine Ammonia Lyase

Check if the same lab product or an alternative is used in the 5 most similar protocols

Error-prone PCR on Anabaena variabilis PAL was performed as described previously^{40 (link)}. PCR was performed using Phusion DNA polymerase or Platinum™ SuperFi II Green PCR Master Mix (ThermoFisher Scientific). E. coli NEB5α (New England Biolabs) was used for plasmid propagation and E. coli MG1655 rph+ was used for screening of libraries and purification of recombinant PAL and its mutants. Sequences of constructed plasmids were confirmed through DNA sequencing (Genewiz). PAL was expressed under constitutive T5 promoter from plasmid pBAV1k carrying chloramphenicol resistance. BFP-tagged PAL⁻ strain was constructed by knocking-in BFP under IPTG-inducible T7 promoter at araC locus using lambda-red recombineering. During the flow cytometry experiments, BFP was induced by adding IPTG (500 μM).

Trivedi V.D., Mohan K., Chappell T.C., Mays Z.J, & Nair N.U. (2021). Cheating the cheater: Suppressing false positive enrichment during biosensor-guided biocatalyst engineering. ACS synthetic biology, 11(1), 420-429.

+ Open protocol

+ Expand

Cloning and Characterizing Insect Gustatory Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols

We referred to published transcriptome data [19 (link)] to screen for Grs expressed in larval mouthparts. As these predicted BmGrs sequences were incomplete or inaccurate, specific primers were designed to obtain full-length coding sequences. PCR was conducted using Platinum SuperFi II Green PCR Master Mix (Invitrogen, Carlsbad, CA, USA) as follows: 98°C for 30 s, followed by 35–40 cycles of 98°C for 10 s, 60°C for 10 s and 72°C for 1 min, and a final extension at 72°C for 5 min. Amplified BmGrs were then cloned into a pEASY-Blunt vector (TransGen Biotech, Beijing, China) and sequenced. Grs that terminated early or were un-cloned were removed and the rest were used as candidate Grs for follow-up experiments (electronic supplementary material, table S2).
To confirm BmGr63 localization in human embryonic kidney 293T (HEK293T) cells, an mScarlet tag with red fluorescence was fused with BmGr63 into the pcDNA3.1 vector. The full-length BmGr63 coding sequence was inserted between BglII and BcuI sites in the pT7Ts expression vector and used for cRNA synthesis.

Zhang S., Tang J., Li Y., Li D., Chen G., Chen L., Yang Z, & He N. (2022). The silkworm gustatory receptor BmGr63 is dedicated to the detection of isoquercetin in mulberry. Proceedings of the Royal Society B: Biological Sciences, 289(1985), 20221427.

+ Open protocol

+ Expand

Genomic DNA Isolation and PCR-based Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA from single-cell clones was isolated using the Quick-DNA Miniprep Kit (Zymo Research). Various primer combinations were tested to find an optimal primer pair for 5′ end 3′ junction PCR. PCRs were performed using Phusion Green Hot Start II High-Fidelity PCR Master Mix (Thermo Fisher Scientific) or Platinum SuperFi II Green PCR Master Mix (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions. PCR products were run on a 1% agarose gel, and DNA from PCR bands were isolated using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Isolated DNA fragments were Sanger sequenced by Eurofins Genomics using the Mix2Seq kit (Eurofins Genomics). Sequencing data were analyzed using SnapGene software (www.snapgene.com).

Mikkelsen N.S., Hernandez S.S., Jensen T.I., Schneller J.L, & Bak R.O. (2023). Enrichment of transgene integrations by transient CRISPR activation of a silent reporter gene. Molecular Therapy. Methods & Clinical Development, 29, 1-16.

+ Open protocol

+ Expand

Full-length CDS Amplification and Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length human CDS of HES6, TLE1, SERPINE1, NOTUM, and LGALS3BP were amplified using Platinum SuperFi II Green PCR Master Mix (Invitrogen—12369050) and cloned into pCAG-IRES-EGFP (a kind gift from Prof Gordon Fishell, Harvard Medical School). Inserts were confirmed by Sanger sequencing.

Channakkar A.S., D’Souza L., Kumar A., Kalia K., Prabhu S., Phalnikar K., Reddy P.C, & Muralidharan B. (2023). LSD1 Regulates Neurogenesis in Human Neural Stem Cells Through the Repression of Human-Enriched Extracellular Matrix and Cell Adhesion Genes. Stem Cells, 42(2), 128-145.

+ Open protocol

+ Expand

Constructing Antibody VH and VL Libraries

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The V_H region of antibody 368_01_C01 was PCR amplified from pINT3 plasmid DNA using pINT3 Nco FWD (TCTCTCCACAGGCGCCATGG) and IgG1 CH1 Xho Rev (CCCTTGGTGGAGGCACTCGAG) primers using Platinum™ SuperFi II Green PCR Master Mix (Invitrogen, 12369010). The PCR product was cloned into pIONTAS1^{25 (link)} vector harboring the naïve V_L lambda and kappa chain libraries using NcoI and XhoI restriction endonucleases. Ligation reactions were carried out for 16 hours at 16 °C and contained 160 ng of insert and 400 ng of vector DNA in a total volume of 40 µL. Ligations were purified using the MinElute PCR Purification Kit (Qiagen, 28004) and eluted in 10 µL nuclease-free water. The purified ligation product was transformed into 200 µL of electrocompetent TG1 cells (Lucigen, 60000-PQ763-F) followed by addition of 6 mL of recovery medium (Lucigen, F98226-1) and incubation at 37 °C for 1 hour at 280 rpm rotation. Cells were plated on 2xTY agar plates supplemented with 100 µg/mL ampicillin and 2% glucose. Dilutions of the transformations were also plated to determine library size, which was 1.01 × 10⁸ for the lambda library and 1.67 × 10⁸ for the kappa library with more than 96% of the transformants being positive for insertion of heavy-chain insert, as determined by colony PCR.

Ledsgaard L., Laustsen A.H., Pus U., Wade J., Villar P., Boddum K., Slavny P., Masters E.W., Arias A.S., Oscoz S., Griffiths D.T., Luther A.M., Lindholm M., Leah R.A., Møller M.S., Ali H., McCafferty J., Lomonte B., Gutiérrez J.M, & Karatt-Vellatt A. (2022). In vitro discovery of a human monoclonal antibody that neutralizes lethality of cobra snake venom. mAbs, 14(1), 2085536.

+ Open protocol

+ Expand

Antibody VH Region Cloning and Library Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The VH region of antibody 368_01_C01 was PCR amplified from pINT3 plasmid DNA using pINT3 Nco FWD (TCTCTCCACAGGCGCCATGG) and IgG1 CH1 Xho Rev (CCCTTGGTGGAGGCACTCGAG) primers using Platinum™ SuperFi II Green PCR Master Mix (Invitrogen, 12369010). The PCR product was cloned into pIONTAS1 (23) vector harboring the naïve VL lambda and kappa chain libraries using NcoI and XhoI restriction endonucleases.
Ligation reactions were carried out for 16 hours at 16 o C and contained 160 ng of insert and 400 ng of vector DNA in a total volume of 40 µL. Ligations were purified using the MinElute PCR Purification Kit (Qiagen, 28004), and eluted in 10 µL nuclease free water. The purified ligation product was transformed into 200 µL of electrocompetent TG1 cells (Lucigen, 60000-PQ763-F) followed by addition of 6 mL of recovery medium (Lucigen, F98226-1) and incubation at 37 o C
for one hour at 280 rpm rotation. Cells were plated on 2xTY agar plates supplemented with 100 µg/mL ampicillin and 2% glucose. Dilutions of the transformations were also plated to determine library size, which was 1.01 × 10 8 for the lambda library and 1.67 × 10 8 for the kappa library with more than 96% of the transformants being positive for insertion of heavy chain insert, as determined by colony PCR.

Ledsgaard L., Laustsen A.H., Puš U., Wade J., Caballero P., Boddum K., Slavny P., Masters E.W., Arias A.S., Oscoz S., Griffiths D.T., Luther A.M., Lindholm M., Leah R.A., Møller M.S., Ali H., McCafferty J., Lomonte B., Gutiérrez J.M., & Karatt-Vellatt A. (2021). In vitro discovery and optimization of a human monoclonal antibody that neutralizes neurotoxicity and lethality of cobra snake venom.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!