Fast universal pcr master mix

Total RNA was extracted using the RNeasy^®Mini Kit (Qiagen, Germantown, MD, USA) and cDNA was synthesized from 1 μg of total RNA using High-Capacity cDNA Reverse Transcription Kits (Bio-Rad) plus SYB^® Gene Expression Assay Mix, sterile water, and Fast Universal PCR Master Mix (Applied Biosystems, Waltham, MA, USA) to measure the expression of specific genes. Gene expression levels were assessed by real-time RT-qPCR using the Taqman^® fast advanced master mix (Thermo Scientific, Waltham, MA, USA) and the CFX96 RT-PCR Detection System (Bio-Rad Laboratories Inc., Hercules, CA, USA). The PCR primer sequences used are: DSTYK forward primer: GAAGAGAAGTACCTCCAGC; DSTYK reverse primer: CAAGAAATCATTCACCAAGT. β-actin forward primer: CACCATTGGCAATGAGCGGTTC; β-actin reserve primer: AGGTCTTTGCGGATGTCCACGT. Gene expression was calculated and presented as fold changes.

cDNA was prepared using TaqMan Gene Expression Cells-to-Ct Kit (Ambion), and qPCR was subsequently performed using Taqman Fast Universal PCR Master Mix and 18 s rRNA reference primer (4319413E), with target primers for nestin (Hs04187831_g1) and vimentin (Hs00958111_m1) using a StepOnePlus Real-Time PCR System (all Applied Biosystems).

Total DNA was extracted from sections of the spleen and mesenteric lymph nodes collected at necropsy to determine the amount of LAB DNA. The spleen and lymph nodes were weighed then processed according to the directions in the DNeasy Blood and Tissue kit (Qiagen, Valencia, CA, USA). The DNA was eluted in 30 µL of water. The LAB DNA was quantified by real-time qPCR using primers and a probe designed by Applied Biosystems and the Taqman Fast Universal PCR Master Mix. The real time qPCR procedure was done as described above. The original amount of LAB vector DNA was calculated based on a standard curve using the CT values generated.

In all cases (22 HCPS, 17 GSW, and 15 pneumonia) routine hematoxylin and eosin (H&E) sections and autopsy reports were reviewed to confirm the identity of tissue segments in each slice. Because each case was associated with more than one FFPE block, a total of 186 sections were sliced. Also, each slice contained distinct tissue segments of one or more organs (e.g., lung, brain, kidney), nearly 500 tissue segments were analyzed. To measure the P2Y₂R expression levels in the tissue segments, RNA was extracted from 10 μm sections of the FFPE blocks using the Qiagen RNeasy FFPE kit (cat# 73504) and the instructions therein. The extracted RNA was quantified with a Thermo Fisher Scientific Nanodrop spectrophotometer. We next synthesized DNA from the sample RNA templates by RT-PCR using random hexamers (Invitrogen, P/N 100026484) and M-MLV reverse transcriptase (Invitrogen, ca# 28025-013). P2Y₂R gene expression levels in the DNA samples were measured in triplicate, using the TaqMan gene expression assay comprising of a Fast Universal PCR Master Mix from Applied Biosystems (cat# 4352042) and a P2ry2 commercial primer probe from Applied Biosystems (Hs04176264_s1 P2ry2) following manufacturer instructions. We used a WT P2Y₂R plasmid with known DNA concentration as a standard. We normalized the P2Y₂R expression levels to the total RNA extracted from the embedded tissues.