Samples of 2 × 10 mL of whole blood were collected in BD Vacutainer K2 EDTA blood collection tubes with lavender Hemogard closure or Streck cell-free DNA BCT and were processed within 4 h from collection for BD Vacutainer K2 EDTA tubes and within 72 h for Streck cell-free DNA BCT. For plasma isolation, blood collection tubes were centrifuged at 15 to 25 °C for 10 min at 1600× g using a swing bucket rotor. The isolated plasma (supernatant) was transferred to centrifuge tubes. For plasma samples from BD Vacutainer K2 EDTA tubes, a centrifugation at 15 to 25 °C for 10 min at 3000× g was performed using a fixed angle rotor, while for plasma samples from Streck cell-free DNA BCT, the isolated plasma was centrifuged at 15 to 25 °C for 10 min at 6000× g using a fixed angle rotor. Highly hemolytic samples were rejected. These steps were based on previously published literature and are in line with the Key Recommendations on Assay Characteristics by the United States National Cancer Institute Colon and Rectal–Anal Task Forces [32 (link)].
Vacutainer k2 edta tubes
Manufactured by BD
Sourced in United States, United Kingdom
The BD Vacutainer K2 EDTA tubes are a type of blood collection tube designed for the collection and transportation of whole blood samples. The tubes contain the anticoagulant K2 EDTA, which helps prevent blood clotting during the collection process.
Automatically generated - may contain errors
Lab products found in correlation
Ficoll paque plus, by GE Healthcare (5 mentions)
Mr frosty, by Thermo Fisher Scientific (4 mentions)
Ficoll paque, by GE Healthcare (4 mentions)
Qiaamp dna blood mini kit, by Qiagen (4 mentions)
Lymphoprep density gradient medium, by STEMCELL (4 mentions)
Sepmate 50, by STEMCELL (3 mentions)
18g needle, by BD (2 mentions)
Mirvana paris kit, by Thermo Fisher Scientific (2 mentions)
Taqman microrna microfluidic cards, by Thermo Fisher Scientific (2 mentions)
Viia7, by Thermo Fisher Scientific (2 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Bovine serum albumin (bsa), by Merck Group (2 mentions)
Lysing buffer, by BD (2 mentions)
Lymphocyte separation media, by Corning (1 mentions)
Recombinant il 2, by Thermo Fisher Scientific (1 mentions)
Macs microbead kits, by Miltenyi Biotec (1 mentions)
Anti cd3 okt3, by Thermo Fisher Scientific (1 mentions)
Il 15, by R&D Systems (1 mentions)
Interleukin 7 (il 7), by R&D Systems (1 mentions)
115 protocols using vacutainer k2 edta tubes
1
Plasma Isolation from Whole Blood
2
Plasma Preparation for miRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood was collected in 10 mL K2 EDTA Vacutainer tubes (Becton Dickinson, USA) by jugular venepuncture, using 18G needles (Becton Dickinson) and stored at 4°C. Within two hours of collection samples were centrifuged at 1,900 g for 10 min at 4°C to remove blood cells, and then again at 16,000 g for 10 min at 4°C to remove cellular debris and platelets. The second centrifugation step has been shown to significantly reduce platelet numbers in plasma samples, minimising platelet contamination [22 (link)]. In addition, haemolysis was controlled for by using absorbance at 414 nm and the ‘miR ratio’ (ΔCq between miR-451 and miR-23a) as described previously [23 (link), 24 (link)]. All plasma samples were immediately frozen at -80°C.
3
Standardization of Plasma miRNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This was a prospective study focusing on the standardization of miRNA extraction from plasma samples collected with EDTA anticoagulant. Whole blood samples were collected from 30 healthy donors. Written informed consents were obtained from all volunteers. The experimental design implemented in this study has been illustrated in Figure 1 .
According to the protocol approved by the Institutional Ethics Committee (Tata Memorial Centre – Institutional Ethics Committee III), approximately 3 mL of whole blood samples were collected in 5 mL K2EDTA vacutainer tubes (BD vacutainer, Becton Dickinson, Plymouth, UK). The samples were spun at 1500xg for 15 min at 4 ºC to separate plasma. Without disturbing the buffy coat, the clear supernatant was transferred to a fresh 2 mL cryotube (Tarsons, Saltlake, Kolkata, India) and inspected for haemolysis. The samples with no visual signs of haemolysis were immediately frozen at - 80 ºC for 4-6 months.
According to the protocol approved by the Institutional Ethics Committee (Tata Memorial Centre – Institutional Ethics Committee III), approximately 3 mL of whole blood samples were collected in 5 mL K2EDTA vacutainer tubes (BD vacutainer, Becton Dickinson, Plymouth, UK). The samples were spun at 1500xg for 15 min at 4 ºC to separate plasma. Without disturbing the buffy coat, the clear supernatant was transferred to a fresh 2 mL cryotube (Tarsons, Saltlake, Kolkata, India) and inspected for haemolysis. The samples with no visual signs of haemolysis were immediately frozen at - 80 ºC for 4-6 months.
4
Peripheral Blood Sampling for CTC Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PB samples were collected in spray-coated K2 EDTA Vacutainer Tubes (Becton Dickinson, Franklin Lakes, NJ, USA) from 9 healthy volunteers and 18 patients with ESs. Blood samples were drawn with the negative pressure syringe, maintained at room temperature and processed within 2 h of collection. PB was collected for CTCs evaluation at a random time during therapy. A second PB sample was obtained from those patients who were hospitalized for a second time. The second PB sample collected from the same patient was analyzed separately. The use of PB and tumor tissue was approved by the multidisciplinary bioethics committee of oncology of the Rizzoli Institute before the inclusion of patients into the study (Prot. Gen 0043699, 29/12/2015), and all patients provided written informed consent.
5
Plasma EV Isolation from Metastatic Melanoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasma samples from patients with unresectable metastatic melanoma stage IIIC–IV were collected for this study from January 2011 to December 2014 and followed-up until December 2016. The study was approved by the Ethical Committee of the Azienda Ospedaliera Universitaria Le Molinette, Torino, Italy and plasma samples were collected from patients after informed consent (Comitato Etico Interaziendale Titolare A/2.10 del 03-07-2014 Prot. N. 0068188). To obtain plasma for the study, 10 mL of blood was collected in K2-EDTA Vacutainer® tubes (Becton Dickinson, Franklin Lakes, NJ, USA, Cat. no. 366643) using a butterfly system with a needle gauge of 21 (Becton Dickinson, Franklin Lakes, NJ, USA, Cat. no. 367281). Blood tubes were then mixed 8 times and processed within 4 h from harvest by centrifugation at 1500× g for 15 min at RT. Plasma was aliquoted in labeled cryotubes and stored at −80 °C prior to use. Before EV isolation, all plasma samples were centrifuged at 1200× g for 20 min at 10 °C to eliminate red blood cells and cellular debris.
6
Blood Collection and Plasma Separation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ten ml of blood was collected from each panel members in K2-EDTA vacutainer tubes (Becton Dickinson, San Diego, California, USA). Out of this, 2–3 ml was used for CD4+ T cell counting and the remaining for plasma separation. Plasma samples were stored in 1 ml aliquots at −20°C till further use.
7
Isolation and Expansion of Memory CD8+ T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were collected in four 10-mL K2 EDTA vacutainer tubes (Becton Dickinson) and processed within 24-30 h to PBMCs or memory CD8+ T cells. A 1-mL sample was removed and centrifuged at 500xg for 10 min to obtain plasma. To isolate PBMCs, blood samples were diluted with an equal volume of MACS separation buffer (phosphate buffered saline, 0.5% bovine serum albumin, 2 mM EDTA), then layered onto lymphocyte separation media (Corning) and centrifuged at 1200xg for 20 min. The interface was removed and washed once with MACS buffer before further processing or cryopreservation. Memory CD8+ T cells were isolated from PBMCs using MACS microbead kits according to the manufacturer’s instructions (Miltenyi). Following separation, purity was confirmed using antibodies to CD3, CD8, CD45RA, CD45RO and CD57 (Biolegend). Immediately following isolation, memory CD8+ T cells were expanded by co-culturing with 2x107 mitomycin C treated (50 μg/mL, 30 min) allogenic PBMCs in the presence of 0.1 μg/mL anti-CD3 (OKT3, eBioscience), 50 U/mL recombinant IL-2 (Peprotech), 5 ng/mL IL-7 and 5 ng/mL IL-15 (R&D Systems). After 10 days of expansion, the cells were collected and cryopreserved.
8
Blood Sample Collection from Gravidas
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were drawn ahead of any procedure. Approximately 3 mL blood from gravidas who were recruited to this study was collected into anti-coagulant K2-EDTA Vacutainer tubes (Becton-Dickinson) with a proprietary preservative (available from Rare Cyte).
9
Blood Plasma Sampling for RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were collected in 10 ml K2 EDTA Vacutainer tubes (Becton Dickinson, USA) by jugular vein puncture, using 18G needles (Becton Dickinson) and instantly stored in ice. Within 2 h of collection, samples were centrifuged at 1900g for 10 min at 4 °C to remove blood cells, followed by second centrifugation at 16,000g for 10 min at 4 °C to remove cellular debris and platelets54 (link). One aliquot of 500 µl of each plasma sample was immediately used for RNA extraction and the remaining aliquots were frozen at − 80 °C. Blood samples were collected from ‘N’ no. of animals falling into four age groups: N = 15 samples/NB; N = 18 samples/4–6 months; N = 18 samples/10–12M; N = 16 samples/15–17M.
10
Quantitative SIV RNA Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SIV RNA concentration in the plasma and CSF samples were measured by quantitative reverse transcription-PCR (qRT-PCR) as previously described (83 (link)). In brief, plasma was separated from blood samples collected in K2-EDTA vacutainer tubes (Becton, Dickinson, San Diego, CA, USA) within 4 h of collection. RNA was extracted from 140 µl of plasma and CSF samples using a QIAamp viral RNA minikit according to the manufacturer’s instructions (Qiagen, Germantown, MD, USA; cat. no. 52906). SIV gag RNA was quantified by qRT-PCR using the TaqMan RNA-to-Ct 1-Step kit (Thermo Fisher Scientific, MA; cat. no. 4392938) and Applied Biosystems QuantStudio 3 real-time PCR system (Applied Biosystems, Waltham, MA, USA). Primers and probes used for SIV gag RNA quantification were as follows: SIVGAGF, 5′-GTCTGCGTCATCTGGTGCATTC -3′; SIVGAGR, 5′-CACTAGGTGTCTCTGCACTATCTGTTTTG -3′; and SIVP, 5′-/6-carboxyfluorescein (FAM)/CTTCCTCAG /ZEN/TGTGTTTCACTTTCTCTTCTGCG /3IABkFQ-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!