Real-time quantitative PCR (qRT-PCR) was performed on p38 in the liver tissue of NL, AR, and HY. Each group had three replicates and β-actin was used as a quantitative reference gene. The primers were designed by Primer Premier 5.0 (Premier, Markham, ON, Canada; Table 1 ). Real-time PCR was performed on an ABI 7900HT instrument (Applied Biosystems, Foster City, CA, USA). The qRT-PCR reaction volume was 20 μL: 10 μL of ChamQ SYBR qRT-PCR Master Mix (Vazyme, Nanjing, China), 0.4 μL of each forward and reverse primer (10 μM), 1.0 μL of cDNA template, and 8.2 μL of RNase-free water. The reaction procedure was set as follows: initial denaturation at 95 °C for 30 s; 95 °C for 10 s; 60 °C for 30 s; 40 cycles. This was followed by a melting curve analysis (95 °C for 10 s, 60 °C for 60 s, and 95 °C for 15 s). The transcript levels of the target gene were analyzed by the 2−ΔΔCt method. All the data are expressed as mean ± SD, with p < 0.05 representing significant differences.
Chamq sybr qrt pcr master mix
Manufactured by Vazyme
Sourced in China
ChamQ SYBR qRT-PCR Master Mix is a pre-mixed solution for quantitative reverse transcription PCR (qRT-PCR) experiments. It contains all the necessary components, including a DNA polymerase, dNTPs, buffer, and a SYBR Green I fluorescent dye, to perform real-time quantitative PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Abi 7900ht instrument, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Rt qpcr primers, by Sangon (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Genespring software v13, by Agilent Technologies (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Omniscript rt kit 50, by Qiagen (1 mentions)
5 protocols using chamq sybr qrt pcr master mix
1
Quantitative PCR of p38 in Liver
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using an RNAiso Plus reagent (TaKaRa, Dalian, China), according to the manufacturer’s instructions. RNA quality was assessed by electrophoresis on a 1.5% agarose gel, and RNA concentration was measured using a NanoDrop 2000 Spectrophotometer (Thermo-Fisher Scientific, Waltham, MA, USA). RNA (~1 µg) was reverse-transcribed into cDNA using the PrimeScriptTM RT Reagent Kit with gDNA Eraser (Takara, Dalian, China). A quantitative real-time PCR (qRT-PCR) was performed in a 10 µL volume containing 5 µL of ChamQ SYBR qRT-PCR Master Mix (Vazyme, Nanjing, China), 0.8 µL of cDNA, 3.4 µL of ddH2O, and 0.4 µL of each forward and reverse primer (10 µM), according to the manufacturer’s protocol. Each experiment was conducted independently three times with three biological replicates. The 2−ΔΔCt method [39 (link)] was used to calculate the relative expression levels. As internal controls, the genes ACTB, GAPDH, and PGK1 were used. All primers used in this work are provided in Supplementary Table S1 .
3
Quantifying miR-195-5p and PDGF in Serum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT‐qPCR was employed to measure the miR‐195‐5p and PDGF levels in the serum of all enrolled study population. The whole blood samples were collected in a 1.5 mL centrifuge tube without RNA enzyme and stored in a refrigerator at −80°C. RNA concentration was determined within 1 week. The blood samples were centrifuged at 3000 rpm for 20 min to extract the supernatant. TRIzol reagent (Thermo Fisher, MA, USA) was utilized to extract total RNA of the samples. Total RNA was isolated using mirVana PARIS kits and cDNA was synthesized by reverse transcription using PrimeScript RT Reagent kits (TaKaRa, Otsu, Shiga, Japan). The concentration and purity of extracted RNA was determined using ultrafine spectrophotometer (NanoDrop One, Thermo Fisher). ChamQ™ SYBR qRT‐PCR MasterMix (Vazyme Biotech, Nanjing, China) was adopted for the RT‐qPCR under reaction conditions of 95°C for 30 s, and 35 cycles of 95°C for 10 s and 60°C for 10 s. The relative levels of miR‐195‐5p and PDGF standardized by internal reference U6 and β‐actin were calculated by the 2−ΔΔCt method (Livak and Schmittgen, 2001 (link)). RT‐qPCR primers were synthesized by Sangon Biotech (Shanghai, China) and the primer sequences are shown in Table 1 .
4
Profiling lncRNA and mRNA Expressions in Liver Diseases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lncRNA and mRNA Human Gene array data were analysed for data summarization, normalization, and quality control using the GeneSpring software V13.0 (Agilent) in the discovery phase. The microarray data were Log2 transformed and median centred by genes using the Adjust Data function of CLUSTER 3.0 software then further analysed with hierarchical clustering with average linkage [17 (link)].
Whole-blood samples from 85 healthy controls, 44 HBV carriers, 40 CHB patients, and 136 LC patients were collected and stored at –80°C in 1.5-mL RNase-free microcentrifuge tubes for later use within 7 days. Total RNA was extracted and cDNAs were synthesized as previously described [18 (link)]. QRT-PCR of lncRNAs was performed using the ChamQTM SYBR qRT-PCR Master mix (Vazyme biotech, Nanjing, China) and quantified using an ABI 7500 Real-Time PCR System (Life Technologies, USA) with the validated specific primer sets. Primer sequences are listed inSupplementary Table 1 . The reaction mixtures were pre-degenerated at 95°C for 30 s, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. The expression levels of candidate genes were normalized to the respective β-actin expression and each sample was analysed in triplicate. The specificity of each PCR was confirmed by melting curve analyses and Ct values >35 were excluded from the analyses. Data analyses were performed using the 2−ΔΔCt method.
Whole-blood samples from 85 healthy controls, 44 HBV carriers, 40 CHB patients, and 136 LC patients were collected and stored at –80°C in 1.5-mL RNase-free microcentrifuge tubes for later use within 7 days. Total RNA was extracted and cDNAs were synthesized as previously described [18 (link)]. QRT-PCR of lncRNAs was performed using the ChamQTM SYBR qRT-PCR Master mix (Vazyme biotech, Nanjing, China) and quantified using an ABI 7500 Real-Time PCR System (Life Technologies, USA) with the validated specific primer sets. Primer sequences are listed in
5
Extraction and Quantification of miR-200a-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 0.5 mL serum sample was added with TRIzol reagent (YT2188, Yitabio, Beijing, China), placed at room temperature for 5 min, added with 0.2 mL chloroform, mixed well, placed at room temperature for 15 min, and centrifuged at 12,000 g for 5 min and the supernatant was transferred to another centrifuge tube. Subsequently, the total RNA was purified using RNA purification kit (DP412, Tiangenbio, Beijing, China) according to the manufacturer’s instructions. The concentration and purification of extracted RNA was determined using an ultraviolet spectrophotometer and cDNA was synthetized using Omniscript RT Kit (50) (Qiagen205111, QIAGEN, Duesseldorf, Germany). The RT-qPCR was performed using ChamQTM SYBR qRT-PCR MasterMix (Vazyme biotech, Nanjing, Jiangsu, China). The reaction system was as follows: pre-denaturation at 95 °C for 10 min and 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s and extending at 72 °C for 10 s. The relative expression of miR-200a-3p standardized by the internal reference U6 was calculated using the 2−ΔΔCt method. The primer sequences are shown in Table 1 .
Real-time PCR primer sequence
| Gene | Forward 5’-3’ | Reverse 5’-3’ |
|---|---|---|
| miR-200a-3p | CGCGTGTAGCAATGGTCTGT | AGTGCAGGGTCCGAGGTATT |
| U6 | CTCGCATCGGCAGCACA | AACGCTACTCGAATTGCGT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!