Pgfp 5 rs
The PGFP-V-RS is a laboratory equipment product manufactured by OriGene. It is designed to perform a core function, but a detailed description cannot be provided while maintaining an unbiased and factual approach without extrapolation.
Lab products found in correlation
31 protocols using pgfp 5 rs
Culturing Human Liver Cancer Stem Cells
Obtaining Recombinant Reelin from Stable Cell Line
Stable Knockdown of Notch1 in Lung Cancer Cells
HOXA9 Overexpression and Silencing
Investigating Mitosis and Virus Replication
Syntenin Knockdown and Rescue
Empty vector, control shRNA and the 29 mer human and mouse shRNA sequences cloned in pGFP-V-RS vector were purchased from Origene [control shRNA GCACTACCAGAGCTAACTCAGATAGTACT (TR30013), Human syntenin shRNA 2 (GCCTAATGGACCACACCATTCCTGAGGTT (TG309594B/GI338370), shRNA 3 (GTGGCTCCTGTAACTGGTAATGATGTTGG (TG309594C/GI338371), Mouse shRNA (TCAGGCTCAAACTGCTTATTCTGCCAATC (TG512166A/GI574570)].
Lentiviral Transduction of SIRT1 shRNA
Knocking Down IKZF1 in Nalm6 Cells
Plasmid Amplification and Purification
Hep3B Cell Maintenance and Plasmid Constructs
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!