Log In Sign up
The largest database of trusted experimental protocols

Af6 120

Manufactured by BioLegend
Visit Supplier

AF6-120.1 is a fluorochrome-conjugated antibody used for flow cytometry analysis. It recognizes the mouse CD55 (decay-accelerating factor, DAF) antigen.

Automatically generated - may contain errors

Lab products found in correlation

M1 70, by BD (4 mentions) Tc11 18h10, by BioLegend (3 mentions) Rb6 8c5, by BioLegend (3 mentions) Rm4 5, by Thermo Fisher Scientific (2 mentions) Ebio13a, by BioLegend (2 mentions) Live dead blue or aqua, by Thermo Fisher Scientific (2 mentions) X54 5 7, by BioLegend (2 mentions) E50 2440, by Thermo Fisher Scientific (2 mentions) H57 597, by Thermo Fisher Scientific (2 mentions) Facscanto 2, by BD (2 mentions) Al 21, by BD (2 mentions) Isotype matched control mabs, by BioLegend (2 mentions) Facscanto 2 flow cytometer, by BD (1 mentions) Smarter race cdna amplification kit, by Takara Bio (1 mentions) H 2kd, by BioLegend (1 mentions) Ideas 6, by Merck Group (1 mentions) Cd3 negative selection kit, by Miltenyi Biotec (1 mentions) Af6 88, by BioLegend (1 mentions) G46 6, by BD (1 mentions) Cd93 aa4, by BioLegend (1 mentions)

9 protocols using af6 120

1

Multiparameter Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
To assess intracellular cytokines, leukocytes were stimulated for 4 hrs with phorbol 12-myristate 13-acetate (10 ng/ml), ionomycin (1 μg/ml) and brefeldin A (10 μg/ml). Cells were washed, fixed in 2% paraformaldehyde, permeabilized with 0.5% saponin buffer and stained with antibodies specific for CD4 (Biolegend – RM4-5), IFN-γ (eBioscience – XMG1.2), IL-4 (eBioscience – 11B11), IL-13 (eBioscience – eBio13A) and IL-17A (Biolegend – TC11-18H10.1). To assess cell populations and macrophage depletion, leukocytes isolated from lung tissue or 72 hrs thioglycollate elicited peritoneal cells (3% w/v) were labelled with a viability dye (Invitrogen – LIVE/DEAD Blue or Aqua), pre-incubated in 2% normal rat serum plus unlabelled anti-CD16/32 antibody (eBioscience – 93), and stained with combinations of antibodies specific for: CD11b (Biolegend – M1/70), CD11c (BD – HL3), CD45 (Biolegend - 30-F11), CD64 (Biolegend – X54-5/7.1), F4/80 (Biolegend – BM8), Gr-1 (Biolegend – RB6-8C5), Ly6C (Biolegend – HK1.4), Ly6G (BD – 1A8), MHC class II I-Ab (BD – AF6-120.1) or I-A/E (Biolegend M5/114.15.2), Siglec-F (BD – E50-2440), and TCRβ (eBioscience – H57-597). Flow cytometry was performed using a FACSCanto II or LSRII (BD Biosciences) and data were analyzed using FlowJo (Tree Star).
Borthwick L.A., Barron L., Hart K.M., Vannella K.M., Thompson R.W., Oland S., Cheever A., Sciurba J., Ramalingam T.R., Fisher A.J, & Wynn T.A. (2015). Macrophages are critical to the maintenance of IL-13-dependent lung inflammation and fibrosis. Mucosal immunology, 9(1), 38-55.
+ Open protocol
+ Expand
2

Isolation and Identification of Macrophage Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells of different macrophage subpopulations were obtained through cell sorting using a FACSCanto II flow cytometer (BD Biosciences), and then stained with antibodies against mouse F4/80 (APC conjugated, BM8, BioLegend) and against MHC-II (PE-conjugated, AF6-120.1, BioLegend).
Peritoneal cells from normal mice were prepared as a negative control. Peritoneal cells were washed and resuspended in perlsucht bacillenemulsion (PBE) containing 0.5% fetal bovine serum (FBS) and were used to fluorescence activated cell sorting (FACS) analysis. Data were analyzed with FlowJo software (version 7.6.1). LPMs were gated as F4/80high MHC-II-, and SPMs were gated as F4/80low MHC-II+.
Chen C., Wang R., Feng W., Yang F., Wang L., Yang X., Ren L, & Zheng G. (2021). Peritoneal resident macrophages in mice with MLL-AF9-induced acute myeloid leukemia show an M2-like phenotype. Annals of Translational Medicine, 9(3), 266.
+ Open protocol
+ Expand
3

Comprehensive Murine Immune Cell Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following mAbs purchased from BioLegend (San Diego, CA) were used: N418 (anti-murine CD11c); 2.4G2 (“Fc block”, anti-murine CD16/CD32); 30-F11 (anti-murine CD45); C/23 (anti-murine CD40); 16-10A1 (anti-murine CD80); GL1 (anti-murine CD86); AF6-120.1 (anti-murine I-Ab); 10F.9G2 (anti-murine PD-L1); TY25 (anti-murine PD-L2); 6d5 (anti-murine CD19); 1A8 (anti-murine Ly-6G); 145-2C11 (anti-murine CD3ε); BM8 (anti-murine F4/80); NLDC-145 (anti-murine CD205); C068C2 (anti-murine CD206); XMG1.2 (anti-IFNγ); TC11-18H10.1 (anti-IL-17A); and TRFK4 (anti-IL-5). The mAb, AL-21 (anti-murine Ly-6C); M1/70 (anti-murine CD11b) and ebio13A (anti-IL-13) were purchased from BD Biosciences (San Diego, CA). The mAb 2f8 (anti-murine CD204) was purchased from AbD Serotec. Monoclonal Abs were primarily conjugated with Alexa Fluor 700, FITC, PE, PE-Cy7, PerCP-Cy5.5, allophycocyanin (APC), APC-Cy7, Brilliant Violet 421, or Pacific blue. Isotype-matched control mAbs (BioLegend) were tested simultaneously in all experiments.
Chen G.H., Teitz-Tennenbaum S., Neal L.M., Murdock B.J., Malachowski A.N., Dils A.J., Olszewski M.A, & Osterholzer J.J. (2016). LOCAL GM-CSF DEPENDENT DIFFERENTIATION AND ACTIVATION OF PULMONARY DENDRITIC CELLS AND MACROPHAGES PROTECTS AGAINST PROGRESSIVE CRYPTOCOCCAL LUNG INFECTION IN MICE. Journal of immunology (Baltimore, Md. : 1950), 196(4), 1810-1821.
+ Open protocol
+ Expand
4

Comparative Analysis of Novel Monoclonal Antibodies

Check if the same lab product or an alternative is used in the 5 most similar protocols
The affinity of the two novel MAb generated (FS1 and W6) were directly compared with known IAg7 or IAb specific antibodies (10–2.16 (ref. 28 (link)) (BioXcell), Y3P29 (link) (ATCC), Y-Ae3 (link) (eBioscience) and AF6-120.1 (ref. 30 (link)) (BioLegend)) by Bio-Layer Interferometry by Precision Antibody (Columbia, MD). Antibody sequences were obtained using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer's instructions. Primers used for reverse transcription were GATTACGCCAAGCTTTATGCAAGGCTTACAACCACA (heavy chain), GATTACGCCAAGCTTCACAATTTTCTTGTCCACCTTGGTGC (heavy chain nested), GATTACGCCAAGCTTCTCATTCCTGTTGAAGCTCTTGACAAT (kappa light chain), GATTACGCCAAGCTTACACTCAGCACGGGACAAACTCTTCTC (lambda light chain 1, 4), GATTACGCCAAGCTTACACTCTGCAGGAGACAGACTCTTTTC (lambda 2,3).
Spanier J.A., Frederick D.R., Taylor J.J., Heffernan J.R., Kotov D.I., Martinov T., Osum K.C., Ruggiero J.L., Rust B.J., Landry S.J., Jenkins M.K., McLachlan J.B, & Fife B.T. (2016). Efficient generation of monoclonal antibodies against peptide in the context of MHCII using magnetic enrichment. Nature Communications, 7, 11804.
+ Open protocol
+ Expand
5

Multiparameter Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
To assess intracellular cytokines, leukocytes were stimulated for 4 hrs with phorbol 12-myristate 13-acetate (10 ng/ml), ionomycin (1 μg/ml) and brefeldin A (10 μg/ml). Cells were washed, fixed in 2% paraformaldehyde, permeabilized with 0.5% saponin buffer and stained with antibodies specific for CD4 (Biolegend – RM4-5), IFN-γ (eBioscience – XMG1.2), IL-4 (eBioscience – 11B11), IL-13 (eBioscience – eBio13A) and IL-17A (Biolegend – TC11-18H10.1). To assess cell populations and macrophage depletion, leukocytes isolated from lung tissue or 72 hrs thioglycollate elicited peritoneal cells (3% w/v) were labelled with a viability dye (Invitrogen – LIVE/DEAD Blue or Aqua), pre-incubated in 2% normal rat serum plus unlabelled anti-CD16/32 antibody (eBioscience – 93), and stained with combinations of antibodies specific for: CD11b (Biolegend – M1/70), CD11c (BD – HL3), CD45 (Biolegend - 30-F11), CD64 (Biolegend – X54-5/7.1), F4/80 (Biolegend – BM8), Gr-1 (Biolegend – RB6-8C5), Ly6C (Biolegend – HK1.4), Ly6G (BD – 1A8), MHC class II I-Ab (BD – AF6-120.1) or I-A/E (Biolegend M5/114.15.2), Siglec-F (BD – E50-2440), and TCRβ (eBioscience – H57-597). Flow cytometry was performed using a FACSCanto II or LSRII (BD Biosciences) and data were analyzed using FlowJo (Tree Star).
Borthwick L.A., Barron L., Hart K.M., Vannella K.M., Thompson R.W., Oland S., Cheever A., Sciurba J., Ramalingam T.R., Fisher A.J, & Wynn T.A. (2015). Macrophages are critical to the maintenance of IL-13-dependent lung inflammation and fibrosis. Mucosal immunology, 9(1), 38-55.
+ Open protocol
+ Expand
6

Comprehensive Immune Cell Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following mAbs purchased from BioLegend (San Diego, CA) were used: N418 (anti-murine CD11c, hamster IgG1); 2.4G2 (“Fc block”) (anti-murine CD16/CD32, rat IgG2b); 30-F11 (anti-murine CD45, rat IgG2b); 16-10A1 (anti-murine CD80, hamster IgG2); GL1 (anti-murine CD86, rat IgG2a); AF6-120.1 (“MHC Class II”) (anti-murine I-Ab, mouse IgG2a); 145-2C11 (anti-murine CD3ɛ, hamster IgG1, k); 6D5 (anti-murine CD19, rat IgG2a), and BM8 (anti-murine F4/80, rat IgG2a). The mAb, AL-21 (anti-murine Ly-6C, Rat IgM); and M1/70 (anti-murine CD11b, rat IgG2b) were purchased from BD Biosciences PharMingen (San Diego, CA). Monoclonal Abs were primarily conjugated with FITC, PE, PerCP-Cy5.5, allophycocyanin (APC), APC-Cy7, or Pacific blue. Isotype-matched control mAbs (BioLegend) were tested simultaneously in all experiments.
Murdock B.J., Teitz-Tennenbaum S., Chen G.H., Dils A.J., Malachowski A.N., Curtis J.L., Olszewski M.A, & Osterholzer J.J. (2014). EARLY OR LATE IL-10 BLOCKADE ENHANCES TH1 AND TH17 EFFECTOR RESPONSES AND PROMOTES FUNGAL CLEARANCE IN MICE WITH CRYPTOCOCCAL LUNG INFECTION. Journal of immunology (Baltimore, Md. : 1950), 193(8), 4107-4116.
+ Open protocol
+ Expand
7

Allogeneic Exosome-Mediated T Cell Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
T cells were isolated from mouse spleen, purified using a CD3-negative selection kit (Miltenyi) and cultured for 4 h with allogeneic exosomes (0, 25, 50, or 100 ug) in AIMV medium. T cell binding was assessed using flow cytometry. The cells were labeled with fluorescent antibodies directed against H-2 Kb (AF6-88.5 Biolegend), H-2Kd (SF1-1.1 Biolegend), I-Ab (AF6-120.1 Biolegend), I-Ad (AMS-32.1 eBioscience), as described elsewhere.6 Briefly for IFC acquisition of cells was performed with the ImageStream instrument (Amnis EMD Millipore), using low-speed fluidics, at 40× magnification. Data analysis was performed using IDEAS 6.1 image processing and statistical analysis software (Amnis EMD Millipore). 3 × 105 leukocytes were analyzed per organ and time point.
Prunevieille A., Babiker-Mohamed M.H., Aslami C., Gonzalez-Nolasco B., Mooney N, & Benichou G. (2021). T cell antigenicity and immunogenicity of allogeneic exosomes. American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons, 21(7), 2583-2589.
+ Open protocol
+ Expand
8

Multiparametric Immunophenotyping of Immune Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human PBMC were stained for CD19 (HIB19; BioLegend), CD14 (M5E2; BD Bioscience) and MHC class II (G46-6; BD Bioscience). Composition of murine immune cells was analysed using the following antibodies: CD3 (145-2C11; BioLegend), CD19 (6D5; BioLegend), CD20 (SA275A11; BioLegend), CD11b (M1/70; BioLegend), CD11c (N418; BioLegend), CD45 (30-F11; BioLegend), Ly6C (HK1.4; BioLegend) and Ly6G (1A8: BioLegend). B cell maturation was analysed using the following antibodies: CD19 (6D5; BioLegend), CD21 (7G6; BD Bioscience), CD23 (B3B4; BD Bioscience), CD93 (AA4.1; BioLegend), CD45R/B220 (RA3-6B2; BioLegend), IgD (11-26c.2a; BioLegend) and IgM (AF6-78; BD Bioscience). Monocyte, macrophage and microglia activation, differentiation and molecules involved in antigen presentation were determined using: CD40 (3/23; BD Bioscience), CD68 (FA-11; BioLegend), CD69 (H1.2F3; BioLegend), CD80 (16-10A1; BioLegend), CD86 (GL-1; BioLegend), MHCII (AF6-120.1; BioLegend) and PD-L1 (MIH5; eBioscience). Fc receptors were blocked using monoclonal antibody specific for murine or human CD16/ CD32 (Murine TruStain FcX; Human TruStain FcX; BioLegend), respectively. Dead cells were stained with the Zombie Fixable Viability™ Kit (BioLegend). Samples were acquired on a BD LSR Fortessa (BD Bioscience). All data evaluation was performed using FlowJo software (FlowJo LLC, Ashland, USA).
Geladaris A., Häusser-Kinzel S., Pretzsch R., Nissimov N., Lehmann-Horn K., Häusler D, & Weber M.S. (2023). IL-10-providing B cells govern pro-inflammatory activity of macrophages and microglia in CNS autoimmunity. Acta Neuropathologica, 145(4), 461-477.
+ Open protocol
+ Expand
9

Multi-parameter Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were stained with primary antibodies against murine CD45 (30-F11, Biolegend cat. no. 103112, RRID: AB_312976), CD11b (M1/70, Biolegend cat. no. 101205, RRID: AB_312788), F4/80 (CI:A3-1, Bio-Rad cat. no. MCA497GA), Ly6C/G (Gr-1) (RB6-8C5, Biolegend catno. 108411, RRID: AB_313376), Lyve1 (ALY7, Thermo Fisher Scientific cat. no. 53-0443-82, RRID: AB_1633415), I-Ab (AF6-120.1, Biolegend cat. no. 116421, RRID: AB_10613291), CD11c (N418, Biolegend cat. no. 117306, RRID: AB_313775), CD64 (X54-5/701, Biolegend cat. no. 139306, RRID: 11219391), CX 3 CR1 (SA011F11, Biolegend cat. no. 149015, RRID: AB_2565699), CD115 (AFS98, Biolegend cat. no. 135509, RRID: AB_2085222), Ly6C (HK1.4, Biolegend cat. no. 128015, RRID: AB_1732087). Methods adhered to published guidelines (Cossarizza et al., 2019) . Analysis was performed on a Fortessa (BD Biosciences), and data were acquired with FACSDiva software (BD Biosciences). Post-acquisition analysis was performed using FlowJo software (Tree Star, FlowJo LLC; Ashland, Oregon) .
Kim J.S., Kolesnikov M., Peled-Hajaj S., Scheyltjens I., Xia Y., Trzebanski S., Haimon Z., Shemer A., Lubart A., Van Hove H., Chappell-Maor L., Boura-Halfon S., Movahedi K., Blinder P, & Jung S. (2021). A Binary Cre Transgenic Approach Dissects Microglia and CNS Border-Associated Macrophages. Immunity, 54(1).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!