Genomic DNA was isolated from PBMC using QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer´s protocol. Concentration and quality of DNA samples were determined by UV absorption (260/280 nm), and DNA was stored at 4°C until usage. Exon 5 of human KLRB1 was amplified by PCR using primers 161-Ex5-sense (5´-GAT ACA CAC ACA GAA CCT GAT ACG TG-3´ ) and 161-R2-antisense (5´-CAA ATA AGT TAG TCT ATT TCC TGT C-3´ ) and 100–250 ng of genomic DNA. Final concentrations were 0.3 μM of each primer, 200 μM dNTPs, 1.5 mM MgCl2 in Taq polymerase reaction buffer, and 2U of Taq polymerase (Qiagen) in a total volume of 30 μl. Samples were amplified using 36 cycles in a Perkin Elmer GeneAmp PCR System 9600 (McKinley Scientific, Sparta, NJ, USA). PCR reaction products (3 μl) were controlled by horizontal ethidium bromide-stained 1% agarose gel-electrophoresis. For sequencing, amplification products were purified from PCR reactions by Nucleospin Extract II (Macherey & Nagel, Düren, Germany) according to the manufacturer´s recommendations. Automated sequencing was performed subsequently using sequencing primer (5´-ACA CAG AAC CTG ATA CGT G-3´ ). Separation and visualization of sequencing products was performed with an ABI PRISM 377 Genetic Analyzer (Life Technologies, Applied Biosystems, Darmstadt, Germany).
Nucleospin extract 2
Manufactured by Macherey-Nagel
Sourced in Germany
NucleoSpin Extract II is a DNA extraction kit designed for the rapid and efficient purification of DNA fragments from agarose gels or enzymatic reactions. The kit utilizes a silica-membrane technology to selectively bind DNA, allowing for the removal of impurities and salts. The purified DNA can then be used for various downstream applications, such as PCR, sequencing, or cloning.
Automatically generated - may contain errors
Lab products found in correlation
Nucleospin tissue kit, by Macherey-Nagel (3 mentions)
Abi 3100 automated capillary dna sequencer, by Thermo Fisher Scientific (2 mentions)
Bigdye terminator v 3.1 cycle sequencing kit, by Macherey-Nagel (2 mentions)
Qiaprep spin miniprep kit, by Qiagen (2 mentions)
Protein g plus agarose, by Santa Cruz Biotechnology (2 mentions)
Taq polymerase, by Qiagen (1 mentions)
Qiaamp dna blood mini kit, by Qiagen (1 mentions)
Genelute bacterial genomic dna kit, by Merck Group (1 mentions)
Omniscript reverse transkriptase kit, by Qiagen (1 mentions)
Nucleospin rna kit, by Macherey-Nagel (1 mentions)
Hotstar taq polymerase, by Qiagen (1 mentions)
Nucleospin extract viral rna kit, by Macherey-Nagel (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Gateway cloning system, by Thermo Fisher Scientific (1 mentions)
Iscript select cdna synthesis kit, by Bio-Rad (1 mentions)
Topo vector, by Thermo Fisher Scientific (1 mentions)
T4 ligase, by Promega (1 mentions)
Topo ta cloning kit for sequencing, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Seqscape v2, by Thermo Fisher Scientific (1 mentions)
33 protocols using nucleospin extract 2
1
KLRB1 Exon 5 Amplification and Sequencing
2
Lactic Acid Bacteria Identification in Cricket Powder
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lactic acid bacteria strains isolated from the cricket powder’s spontaneous fermentation were identified by 16S rRNA amplification and sequencing. DNA was extracted, and the 16S rRNA gene was amplified in a thermocycler (Techne LTD, Cambridge, UK) using the primers FD1 (5′ CAACAGAGTTTGATCCTGGCTCAG 3′) and RD1 (5′ GCTTAAGGAGGTGATCCAGCC 3′) [26 (link)]. Amplicons were purified using Nucleo Spin Extract II (Macherey-Nagel GmbH & Co. KG, Düren, Germany) and subjected to Sanger sequencing at BMR Genomics (Padua, Italy). The sequences obtained in the FASTA format were compared with those deposited in GenBank DNA database (http://www.ncbi.nlm.nih.gov/ ) using the basic BLAST search tools.
3
Identifying Bacteriocin Resistance Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EntEJ97 and EntK1-resistant mutants were obtained by spot-on-lawn assay using 20 μl of bacteriocin with concentration 1.0–0.1 mg/ml. After overnight incubation at 30°C, resistant colonies of E. faecalis LMG3358 (resistant to EntEJ97) and E. faecium LMG2787 (resistant to EntEJ97 and EntK1) appeared within the inhibition zones. Resistant isolates were picked and re-streaked on plates for pure cultures before frozen cultures containing 15% glycerol were made and stored at -80°C. The level of resistance against EntEJ97 and EntK1 was determined by a microtitre plate assay (Holo et al., 1991 (link)). DNA from the bacteriocin resistant mutants was extracted from overnight cultures with a GenEluteTM Bacterial Genomic DNA Kit (Sigma–Aldrich) and PCR of the rseP gene was performed using primers Ent, EF (F, M, R) (Table 2 ). For sequencing of E. faecium LMG2787 mutants with transposons inside rseP, additional primers (EF_R2, T1_F, T2_F, and T3_F) were created (Table 2 ). PCR products were purified with NucleoSpin Extract II (Macherey-Nagel, Düren, Germany) and sent to GATC Biotech, Germany, for sequencing.
4
MHC Class II Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complete RNA was isolated from native lung tissue before transplantation from both, donor and recipient, with NucleoSpin RNA Kit (Macherey & Nagel, Dueren, Germany). Subsequent cDNA synthesis was accomplished with Omniscript Reverse Transkriptase-Kit (QIAGEN, Hilden, Germany) with oligo-dT Primers. cDNA was amplified with HotStar Taq polymerase (QIAGEN) using oligonucleotide primers ScDQB5a: 5′-GGC TGT GTT GAC TAC CAT TA-3′ and ScDQB3a: 5′-AGA CCA GCA GGT TGT GG-3′ for the second exon (β1 domain) of the MHC II molecule.12 (link) Clean up of DNA was facilitated by NucleoSpin Extract II (Macherey & Nagel, Dueren, Germany). Sequencing of both strands was done by SeqLab (Goettingen, Germany).
5
Genome-wide DNA:RNA hybrid detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DRIP was performed as previously described.56 (link) Briefly, cells (1 × 107) were washed with ice-cold PBS and resuspended in 1.6 mL of TE buffer. Then, 50 μL of 20% (w/v) SDS and 5 μL of 20 mg/mL proteinase K were added and further incubated at 37 °C for 12 h. DNA lysate was poured directly into the Maxtract phase-lock gel tube (Qiagen) and 1 vol (1.6 mL) of phenol/chloroform/isoamyl alcohol (25:24:1) was added. DNA was precipitated with NaAc. The DNA pellet was air-dried and sobulized in TE buffer. Extracted genomic DNA was digested using a cocktail of restriction enzymes (BsrGI, EcoRI, HindIII, SspI and XbaI) at 37 °C overnight. Digested DNA was then isolated using phenol-chloroform precipitation. 8 μg of extracted DNA were diluted in DRIP binding buffer (10 mM sodium phosphate, pH 7, 140 mM NaCl and 0.05% (v/v) Triton X-100). Twenty micrograms of the S9.6 antibody were added to the diluted DNA and further incubated for 14–17 h at 4 °C. Then protein G PLUS-agarose (Santa Cruz Biotechnology Inc.) was added and incubated for 2 h at 4 °C. Precipitates were isolated using NucleoSpin Extract II (Macherey-Nagel).
6
Canine Distemper Virus RNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from either conjunctival swabs or tissue homogenates using NucleoSpin Extract Viral RNA Kit (Macherey-Nagel, Düren, Germany). Oligonucleotide primers were specifically designed to regions on whole CDV genome (Supplementary Table S1 ). The RT-PCR reactions were performed using a one-step RT-PCR system kit (AccessQuickTM, Promega, USA). Amplification steps were optimized according to Tm of primers. The PCR products were visualized by 1.5% agarose gel electrophoresis in Tris-borate-EDTA (TBE) and stained with 10% ethidium bromide for observation under a UV illuminator. The amplicons were purified by NucleoSpin Extract II (Macherey-Nagel, Düren, Germany) following to manufacturer’s instructions and submitted for genetic sequencing (1st BASE Pte Ltd, Singapore).
7
Sturgeon Mitochondrial DNA Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA was extracted from fin-clips of all parental individuals using the NucleoSpin®tissue kit (MACHEREY-NAGEL). Amplification followed a standard PCR protocol to amplify a 620 bp mtDNA fragment of the control region[54 (link)]. The PCR reaction was carried out under the following conditions: 95°C for 120 s, 5 cycles of 95°C for 60 s, 53 °C for 60 s, and 72°C for 60 s; 30 cycles of 95°C for 30 s, 53°C for 45 s, and 72°C for 60 s; and a final extension at 72°C for 12 min. The PCR products were purified using NucleoSpin® Extract II (MACHEREY-NAGEL) and sequenced in both directions by Macrogen (Seoul, Korea). Sequences were aligned using Geneious 5.4 software [55 ] and BLASTed against the NCBI nucleotide collection using Mega-BLAST. This NCBI database contains previously published sequences of the control region for most sturgeon species (http://www.ncbi.nlm.nih.gov/ ).
8
Quantification of F. psychrophilum DNA by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
F. psychrophilum DNA was amplified by PCR with primers F. psychroP1F and F.psychroP1R. The products were purified with PCR clean-up NucleoSpin® ExtractII (Macherey-Nagel, Germany) and quantified with a Nanodrop spectrophotometer (ND1000, Witek, Switzerland). The total amount of DNA measured was divided by 1.797 × 10−7 pg [the weight of one rpoC fragment (164 bp) [54 (link)-56 (link)]]. The result was an estimate of the number of gene copies in 1 μl of purified product. Serial dilutions from 1 × 107 to 1 × 100 copies/μl of amplified DNA were used to calculate the Limit of Detection (LOD) of the qPCR and as quantitative standards for further analyses.
Serial 10-fold dilutions were made starting from F. psychrophilum suspensions [Optical Density (OD595) 0.3 ± 0.02] corresponding to (3 × 109) ± (7 × 108) cells/ml [16 ]. Each suspension was extracted with DNeasy Blood & Tissue Kit (QIAGEN - Switzerland) and used to determine the quantification limit (QL).
Serial 10-fold dilutions were made starting from F. psychrophilum suspensions [Optical Density (OD595) 0.3 ± 0.02] corresponding to (3 × 109) ± (7 × 108) cells/ml [16 ]. Each suspension was extracted with DNeasy Blood & Tissue Kit (QIAGEN - Switzerland) and used to determine the quantification limit (QL).
9
Cloning and Tagging of Isoforms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Isol-RNA Lysis Reagent (5 Prime) and cDNA synthesized using iScript Select cDNA Synthesis Kit (BioRad) with OligodT and a Random Primers (for cloning the different mRNAs) or specific primer (for identification of transcripts). PCR for transcript identification and cloning of different isoforms was done using specific primers listed in Table S1 . Amplification products were purified using NucleoSpin Extract II (Macherey Nagel) and cloned into the TOPO entry vector (Invitrogen).
Protein tagged versions were generated using the primers listed inTable S1 , cloned into TOPO vector (Invitrogen) for FLAG versions or pCR8 vector for HA version, and subcloned into the S2 cell expression vector pMT-DEST48 (Invitrogen) using the Gateway cloning system (Invitrogen).
Protein tagged versions were generated using the primers listed in
10
Targeted Mutagenesis of Melanopsin Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To produce multiple mutations
in the carboxy-tail region of the gene, two unique restriction sites
(BlpI and XhoI) were introduced
by site-directed mutagenesis on either side of the region of interest
through silent mutations. Insertions were confirmed by sequencing
using plasmid-specific primers (GENEWIZ, Inc.). A 98-base oligonucleotide
was synthesized (IDT DNA) and made double-stranded by PCR amplification.
Double-stranded DNA and the plasmid containing the melanopsin gene
were digested with BlpI and XhoI
FastDigest enzymes (Fermentas) for 30 min and separated on an agarose
gel. Bands corresponding to the expected size were excised from the
gel, recovered (Nucleospin ExtractII, Machery-Nagel), and ligated
with T4 ligase (Promega). Ligated plasmid was transformed as above
and subsequently sequenced (GENEWIZ, Inc.) to confirm insertion.
in the carboxy-tail region of the gene, two unique restriction sites
(BlpI and XhoI) were introduced
by site-directed mutagenesis on either side of the region of interest
through silent mutations. Insertions were confirmed by sequencing
using plasmid-specific primers (GENEWIZ, Inc.). A 98-base oligonucleotide
was synthesized (IDT DNA) and made double-stranded by PCR amplification.
Double-stranded DNA and the plasmid containing the melanopsin gene
were digested with BlpI and XhoI
FastDigest enzymes (Fermentas) for 30 min and separated on an agarose
gel. Bands corresponding to the expected size were excised from the
gel, recovered (Nucleospin ExtractII, Machery-Nagel), and ligated
with T4 ligase (Promega). Ligated plasmid was transformed as above
and subsequently sequenced (GENEWIZ, Inc.) to confirm insertion.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!