Takara rnaiso plus

For RT-PCR and qRT-PCR, total RNA was extracted from 10-day-old seedlings using Takara RNAiso Plus (Takara Bio Inc., Otsu, Japan). After RNase-free DNase I (RQ1 RNase-Free DNase; Promega, Madison, WI, USA) treatment, 3 μg of RNA was used for first-strand cDNA synthesis (RevertAid First Strand cDNA Synthesis Kit; Fermentas, Waltham, MA, USA). Takara SYBR Premix Ex Taq (Takara Bio Inc.) and a 7500 Real-Time PCR Instrument (Applied Biosystems, Foster City, CA, USA) were used for qRT-PCR.

Total RNA was extracted from fungal hyphae using TaKaRa RNAiso Plus (TaKaRa, Dalian, China) following manufacturer’s instructions. For cDNA synthesis, TransScript^® II One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China) were used. Real-time quantitative PCR was performed in a CFX96™ Real Time PCR system (Bio-Rad, Hercules, CA) using TransStart^® Tip Green qPCR SuperMix (TransGen Biotech, Beijing, China). Gene expression levels were calculated relative to β-tubulin gene (Ch063_01222) using the 2^−∆∆Ct method^{50 (link)}.

Total RNA was isolated from the frozen tissues using Takara RNAiso Plus (Takara Bio. Inc.) according to the manufacturer's protocol. Genomic DNA (gDNA) was removed and cDNA was reverse-transcribed by using Takara PrimeScript^TM RT reagent Kit with gDNA Eraser (Takara Bio. Inc.) in a T100^TM Thermal Cycler System (BioRad, USA). The experimental protocol utilized was first gDNA removal (42°C 2 min), followed by reverse transcription (37°C 15 min, 85°C 5 s). Subsequently, all samples were amplified by a 25 μl reaction volume in a CFX96^TM Real-time PCR Detection System (BioRad), using SYBR® Premix Ex Taq^TM II (Takara Bio. Inc.). All samples were run in triplicate. OTR, α₁-adrenoreceptor subtypes (α_1aARs, α_1bARs, α_1dARs), endothelial NOS (eNOS) and neuronal (nNOS) were investigated. The amplification program was repeated for 40 cycles (OTR: 95°C 10 s, 58°C 30 s, 72°C 30 s. α_1aARs, α_1bARs, α_1dARs, eNOS, and nNOS: 95°C 5 s, 60°C 50 s). Primer sequences are shown in Table 1. For relative quantification, gene expression was normalized to expression of the glyceraldehyde 3-phosphate dehydrogenase (GAPDH housekeeping gene) and compared by 2^−ΔΔCT method.

The expression levels of efflux system genes (adeB, adeJ, and abeM) were assessed using fluorescence quantitative real-time reverse transcription-PCR (qRT-PCR). The adeB gene was screened as described previously (Peleg et al., 2007 (link)) and new primers were designed for the adeJ (adeJ-F: ATGAGAAA CTGATTGCAGCTC; adeJ-R: TGAGGAGTATCTTCCTGAC CA) and abeM (abeM-F: AGGCTTCGGCTTATCGAAAC; abeM-R: AGAGGGCTAAGGACCAATGC) genes.
The RNA was extracted using TaKaRa RNAiso Plus (TaKaRa Bio Inc., Japan), and cDNA was synthesized using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa Bio Inc., Japan). Real-time PCR assays were performed using an Option 2 real-time PCR detection system (Bio-Rad Inc., United States) with the SsoFast EvaGreen Supermix Kit (Bio-Rad Inc., United States). The 16S rRNA gene was used as the internal control gene. Expression analysis was performed using the 2^–ΔΔCt method (Livak and Schmittgen, 2001 (link)) to compare the relative expression of the mRNA with that of A. baumannii ATCC 19606.

Total RNA was extracted from each group of cells according to the TaKaRa RNAiso Plus (9180, TaKaRa Bio, China) instructions. Total RNA was dissolved in DEPC water, and its OA value at 260 nm and 280 nm was measured by NanoDrop ND2000 (Thermo Scientific). The RNA purity and concentration ​​were sequentially calculated. Complementary DNA (cDNA) was reverse transcribed using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A, TaKaRa Bio, China). The reaction system was 10 μl, and the reaction conditions were 37°C for 15 minutes, followed by 85°C for 5 s and 4°C for 4 minutes. The primers for the target genes (Per2 and GAPDH) were designed using Oligo7.0 software (The sequences are listed in Supplementary Table S1). PCR amplification was conducted using a C-1000^TM Thermal Cycler (Bio-Rad, CA, USA). Real-time PCR was performed using TB Green^® Premix Ex Taq™ II (Tli RNaseH Plus) (RR820A, TaKaRa Bio, China) according to the manufacturer's instructions. The reaction conditions were 40 cycles of 95°C for 90 s and 95°C for 10 s and 60°C for 30 s. The relative expression level of the desired gene was analyzed using the 2^-ΔΔCt method.

Total RNA was isolated from the frozen tissues using Takara RNAiso Plus (Takara Bio. Inc., Otsu, Shiga, Japan) according to the manufacturer's protocol. Genomic DNA (gDNA) was removed and cDNA was reverse-transcribed using Takara PrimeScript^TM RT reagent Kit with gDNA Eraser (Takara Bio. Inc., Otsu, Shiga, Japan) in a T100^TM Thermal Cycler System (BioRad, USA). The experimental protocol utilized was first gDNA removal (42°C, 2 min), followed by reverse transcription (37°C 15 min, 85°C 5 s). Subsequently, all samples were amplified by a 25 μl reaction volume in a CFX96^TM Real-time PCR Detection System (BioRad, USA), using SYBR^® Premix Ex Taq^TM II (Takara Bio. Inc., Otsu, Shiga, Japan). All samples were run in triplicate. The seven identified genes were investigated. The amplification program was repeated for 40 cycles. Primer sequences are shown in Table 1. For relative quantification, gene expression was normalized to expression of GAPDH housekeeping gene and compared by 2^−ΔΔCT method.