From January 2015 to December 2016, we collected a total of 66 frozen surgically resected CRC tissues with AJCC stage II/III at The First Affiliated Hospital of Zhengzhou University. Follow up was concluded five years after surgery. Detailed baseline data of CRC patients were displayed in Additional file 1 : Table S1. Total RNA was isolated from CRC tissues using RNAiso Plus reagent (Takara, Dalian, China) according to the manufacturer’s instructions. RNA quality was evaluated using a NanoDrop One C (Waltham, MA, USA), and RNA integrity was assessed using agarose gel electrophoresis. An aliquot of 1 µg of total RNA was reverse-transcribed into complementary DNA (cDNA) according to the manufacturer’s protocol using the miRNA reverse transcription Kit (TaKaRa BIO, Japan). All cDNA samples were prepared for qRT-PCR. This project was approved by the Ethics Committee Board of The First Affiliated Hospital of Zhengzhou University. In the qRT-PCR analysis, the enrolled 6 genes in the model were detected. qRT-PCR was performed using SYBR Assay I Low ROX (Eurogentec, USA) and SYBR® Green PCR Master Mix (Yeason, Shanghai, China). The expression value of the target genes was normalized to GAPDH, and then log2 transformed for subsequent analysis. The primer sequences of the included 6 genes and GAPDH were shown in Additional file 1 : Table S2.
Mirna reverse transcription kit
Manufactured by Takara Bio
Sourced in Japan, China
The MiRNA reverse transcription kit is a laboratory tool used to convert microRNA (miRNA) molecules into complementary DNA (cDNA) for further analysis. It provides the necessary enzymes and reagents to perform this reverse transcription process, which is a crucial step in the study and quantification of miRNA expression levels.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Rnaiso plus reagent, by Takara Bio (4 mentions)
Tb green fast qpcr mix, by Takara Bio (3 mentions)
High capacity cdna reverse transcription kit, by Takara Bio (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Sybr assay 1 low rox, by Eurogentec (2 mentions)
Sybr green pcr master mix, by Yeasen (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Mirna extraction kit, by Tiangen Biotech (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
U6 primer, by RiboBio (1 mentions)
Mirna specific assay kit, by Takara Bio (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Sybr primescript mirna rt pcr kit, by Takara Bio (1 mentions)
Revertra ace qpcr rt kit, by Toyobo (1 mentions)
Cfx96 system, by Bio-Rad (1 mentions)
Thunderbird sybr qpcr mix, by Toyobo (1 mentions)
22 protocols using mirna reverse transcription kit
1
Colorectal Cancer Tissue RNA Isolation and Gene Expression Analysis
2
Quantification of miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA, including small RNAs and mRNA, was extracted using the TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instruction. The concentration of RNA was determined using a NanoDrop spectrophotometer (NanoDrop, USA). The miR-497 stem-loop primer, U6 primer, mRNA primer, and GAPDH primer were bought from Guangzhou RiboBio Co., LTD. The expression of miR-497 was assayed using stem-loop RT, followed by real-time PCR analysis. MiR-497 cDNA was synthesized from total RNA using the miRNA reverse transcription kit (TaKaRa, Dalian, China), and the expression levels of miR-497 were quantified using the miRNA-specific assay kit (TaKaRa, Dalian, China). U6 snRNA was used as an internal control. Reverse transcription of the mRNAs were performed using the PrimeScript RT reagent kit (TaKaRa, Dalian, China), and the expression levels of the mRNAs were determined using SYBR Premix Ex Taq (TaKaRa, Dalian, China), with GAPDH as an internal control. Real-time PCR was performed on a real-time PCR instrument (CFX96, BIORAD, USA). The results of the qRT-PCR analysis were determined based on the threshold cycle (Ct), and the relative expression levels were calculated using the 2-ΔΔCt method, after normalization to the expression of the internal control gene.
3
Quantitative RNA Profiling in THP-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the differently treated THP-1 cells using Trizol reagent (Invitrogen, USA). The total RNA was synthetized to cDNA using a miRNA reverse transcription kit (Takara, Japan). The qRT-PCR assay was measured with a cDNA template on an ABI 7500 fast PCR system. GAPDH and U6 were used as the internal reference genes for circRNAs and miRNAs. The relative expressions were analyzed by the 2-△△Ct method. The sequence for each primer is shown in Table 1 .
4
Quantitative RT-PCR Analysis of Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 1.0 μg of RNA from transfected cells and negative controls was reverse-transcribed using the ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan) or an miRNA reverse transcription kit (Takara, Dalian, China) according to the manufacturer’s instructions. Quantitative real-time PCR (qRT–PCR) was performed with specific primers (Table S1 ) using THUNDERBIRD™ SYBR qPCR mix (TOYOBO) or a SYBR PrimeScript™ miRNA RT–PCR kit (Takara, Dalian, China) according to the manufacturer’s recommendations. Real-time quantitative PCR was performed on a CFX96 System (Bio-Rad, Hercules, CA, USA). For each cDNA sample, amplification of specific mRNA or miRNA sequences was performed in at least three independent experiments. Relative expression levels were determined by the ∆∆Ct method using the housekeeping genes GAPDH and U6 for normalization (Zhu et al., 2013 (link)).
5
Extraction and Quantification of Cellular RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LncRNAs and messenger RNAs (mRNAs) were extracted from the cells using TRIzol® (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA, USA) and miRNAs were extracted with a miRNA Extraction Kit obtained from Tiangen (Beijing, China) according to the manufacturer’s instructions. A PrimeScript™ RT Reagent kit (TaKaRa Bio, Inc., Shiga, Japan) was used to synthesize complementary DNA (cDNA) from the lncRNA and mRNA. miRNAs were reverse transcribed using a miRNA reverse transcription kit (TaKaRa Bio Inc.). Real-time quantitative PCR (RT-qPCR) analysis was performed in triplicate for each sample using TB Green® Fast qPCR Mix (TaKaRa Bio Inc.) with GAPDH/U6 as the endogenous control. A two-step cycling condition was selected for RT-qPCR. The following thermocycling conditions were used: 1 cycle at 95°C for 30 s, followed by 40 cycles of 95°C of denaturation for 5 s, 60°C combined annealing and extension stages for 10 s, and maintenance at 4°C. Data were analyzed using the 2−ΔΔCq method. The primers used are shown in Supplementary Table S1
6
Profiling CircRNA, mRNA, and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from using TRIzol reagents (Thermo Fisher Scientific). circ_0006789 and HSF1 were treated with PrimeScript™ RT Master Mix (Takara, Shiga, Japan), while miR-615-5p was detected with miRNA reverse transcription kit (TaKaRa). PCR was performed using the SYBR® Premix Ex TaqTM II kit (TaKaRa) on the StepOnePlus real-time PCR system (Thermo Fisher Scientific). GAPDH and U6 were internal parameters to calculate the relative gene expression by 2−ΔΔCt method. The primers are listed in Table 2 .
Primers
| Genes | Forward primers | Reverse primers |
|---|---|---|
| circ_0006789 | GACCCAGACCCTCTCCTTTC | CCGTTCCAGATTTTCTCCAGG |
| SLC25A43 | CTGGAACCATCGTACAGGGG | CCCCTGGGCCTTCACTATCT |
| HSF1 | CATGAGAATGAGGCTCTGTG | CTACGCTGAGGCACTTTTCA |
| miR-615-5p | ATGCAGGGTCCGAGGTATTC | GGGGGTCCCCGGTGCT |
| U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
| GAGPH | TGTGGGCATCAATGGATTT | ACACCATGTATTCCGGGTCAAT |
7
RNA Extraction and miRNA Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As previously described [17 (link), 21 (link)], total RNA from chondrocytes and cartilage tissues was extracted using TRIzol (CW Biotech, Beijing, China). RT-qPCR was performed after reverse transcription as per the protocol provided with the miRNA reverse transcription kit (TaKaRa, Japan). β-Actin levels were used as the internal reference. Relative miRNA expression was calculated using the 2−ΔΔCt method. Table 1 lists the sequences for the used.
8
Quantifying miR-15a-5p Expression from Lung Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the lung tissue samples or transfected pulmonary artery smooth muscle cells (PASMCs; see below) using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. cDNA was synthesized from total RNA using the miRNA reverse transcription kit (Takara Biotechnology Co., Ltd.). The expression of miR-15a-5p was measured in triplicate on a Prism 7300 real-time PCR machine (Applied Biosystems; Thermo Fisher Scientific, Inc.) using SYBR Premix Ex Taq (Takara Biotechnology Co., Ltd.) using the following thermo-cycling conditions: Pre-denaturation at 95°C for 10 min and amplification at 95°C for 30 sec and at 60°C for 30 sec for 40 cycles. The sequences of primer pairs used to screen the transgenic mice were as follows: miR-15a, forward 5′-GTC CTC ATC GCA TAC CAT ACA-3′ and reverse 5′-GCT GAA GTA AGG TTG GCA ATA-3′; U6 forward 5′-GCT TCG GCA GCA CAT ATA CTA AAA T-3′ and reverse 5′-CGC TTC ACG AAT TTG CGT GTC AT-3′. The relative expression levels were calculated using the 2−ΔΔCq method (18 (link)).
9
Quantifying Gene Expression Using RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using TRIzol reagent (Invitrogen/Thermo Fisher Scientific). To ensure the integrity and quality of RNA, samples were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific) for concentration and purity, and RNA integrity was confirmed by agarose gel electrophoresis. Complementary DNA (cDNA) was synthesized from lncRNA and mRNA using the PrimeScript™ RT Reagent Kit (TaKaRa Bio, Kusatsu, Japan). miRNA reverse transcription was performed using the miRNA Reverse Transcription Kit (TaKaRa Bio). For real-time quantitative PCR (RT-qPCR), the TB Green Fast qPCR Mix (TaKaRa Bio) was utilized, with GAPDH and U6 serving as internal controls for mRNA and miRNA, respectively. The thermal cycling conditions were as follows: initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 10 s, with a final hold at 4 °C. The 2-ΔΔCt method was used for data analysis, allowing for relative quantification of gene expression. Primer sequences for all targets and controls are listed in Supplementary Table S2 .
10
Quantitative Analysis of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (Thermo Fisher Scientific). A miRNA reverse
transcription kit (Takara Bio, Kyoto, Japan) was used for reverse transcription
of miRNAs. The mRNA was reverse transcribed into cDNA using a reverse
transcriptase kit (Thermo Fisher Scientific). The PCR reaction mixture was
prepared in a 0.2-mL tube. U6 and glyceraldehyde 3-phosphate dehydrogenase
(GADPH) were used as internal references for miRNA and mRNA, respectively. qPCR
was performed using SYBR Green mix (Novoprotein, Shanghai, China). Relative
expression was calculated using the 2–△△Ct method.
transcription kit (Takara Bio, Kyoto, Japan) was used for reverse transcription
of miRNAs. The mRNA was reverse transcribed into cDNA using a reverse
transcriptase kit (Thermo Fisher Scientific). The PCR reaction mixture was
prepared in a 0.2-mL tube. U6 and glyceraldehyde 3-phosphate dehydrogenase
(GADPH) were used as internal references for miRNA and mRNA, respectively. qPCR
was performed using SYBR Green mix (Novoprotein, Shanghai, China). Relative
expression was calculated using the 2–△△Ct method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!