Illustra gfx 96 pcr purification kit

Manufactured by GE Healthcare

Sourced in United States

The Illustra GFX 96 PCR Purification Kit is a laboratory equipment product designed for the purification of PCR products. It provides a simple and efficient method for the purification of DNA fragments from PCR reactions, allowing for the removal of unwanted components such as primers, nucleotides, and salts.

Automatically generated - may contain errors

Lab products found in correlation

Taq buffer, by Thermo Fisher Scientific (1 mentions) Dntp mix, by GE Healthcare (1 mentions) Platinum taq dna polymerase, by Thermo Fisher Scientific (1 mentions) Bigdye kit, by Thermo Fisher Scientific (1 mentions) Mastercycler gradient, by Eppendorf (1 mentions) Bigdye terminator v1.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions) Bigdye xterminator purification kit, by Thermo Fisher Scientific (1 mentions) Standard taq, by New England Biolabs (1 mentions) Standard taq buffer, by New England Biolabs (1 mentions)

4 protocols using illustra gfx 96 pcr purification kit

Amplification and Sequencing of ARHD Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR amplification of the ARHD genes from the plasmid clones was performed in 96‐well PCR plates in a final volume of 25 μl using the primers M13F (5′ CGC CAG GGT TTT CCC AGT CAC GAC 3′) and M13R (5′ TTT CAC ACA GGA AAC AGC TAT GAC 3′). PCR reaction contained 1X Taq buffer (Invitrogen), 1.5 mmol/L MgCl₂, 0.2 mmol/L dNTP mix (GE Healthcare), 0.4 μmol/L of each primer, 2 U Platinum Taq DNA polymerase (Invitrogen) and 1 μl (10 ng/μl) of plasmid DNA. The reaction was conducted in an Eppendorf Mastercycler Gradient (Eppendorf Scientific, New York, USA) and the amplification program consisted of an initial denaturation at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 20 s and extension at 72°C for 90 s, and a final extension step at 72°C for 5 min. The PCR products were purified using the Illustra GFX 96 PCR Purification Kit (GE Healthcare Life Sciences) and checked on 1% agarose gel electrophoresis (Fisher Scientific, MA). The purified PCR products were then used as template for sequencing reaction using Big Dye kit (Life Technologies) and the primers M13R, according to manufacturer's guidelines. The sequencing of ARHD gene library was performed using the ABI 3500 XL platform (Applied Biosystems^® 3500 XL).

de Sousa S.T., Cabral L., Lacerda Júnior G.V, & Oliveira V.M. (2017). Diversity of aromatic hydroxylating dioxygenase genes in mangrove microbiome and their biogeographic patterns across global sites. MicrobiologyOpen, 6(4), e00490.

+ Open protocol

+ Expand

Bacterial Strain Identification via 16S and 23S rDNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

A PCR master mix (20 μl) was made as described above using 1 μl of 10 mM 23S 6F primer with sequence 5′-GCGATTTCYGAAYGGGGRAACCC and 1 μl of 10 mM 23S R primer with sequence 5′- TTCGCCTTTCCCTCACGGTACT (where Y is C or T and R is A or G) (Anthony et al., 2000 (link)).
For both 16S rDNA and 23S rDNA, the PCR amplification conditions were: 96°C for 3 min, followed by 35 amplification cycles (94°C for 30 s, 48°C for 30 s, 72°C for 90 s), and a final extension at 72°C for 7 min, using a PTC200 DNA Thermal Cycler (MJ Scientific, USA). Finally, the PCR products were separated on 1.5% agarose gels at ≤ 5 V/cm, then the bands were visualized under UV light; 700 and 400 bp bands were excised for 16S rDNA and 23S rDNA, respectively and eluted from the gels (Illustra GFX 96 PCR Purification kit, GE Healthcare, USA). The purified DNA was sequenced at the Genomic Facility Laboratory at the University of Guelph. For 16S, primers 1492r and 799f were used for sequencing, while for 23S, primer 23S 6F was used. Bacterial strains were identified based on 16S rDNA and 23S rDNA sequence comparisons using BLAST searches to GenBank. To assist with taxonomic identification, 16S rDNA sequences for the three Paenibacillus sp. were used to generate a phylogenetic tree using Phylogeny.fr (Dereeper et al., 2008 (link), 2010 (link)).

Mousa W.K., Shearer C.R., Limay-Rios V., Zhou T, & Raizada M.N. (2015). Bacterial endophytes from wild maize suppress Fusarium graminearum in modern maize and inhibit mycotoxin accumulation. Frontiers in Plant Science, 6, 805.

+ Open protocol

+ Expand

TERT Promoter Mutational Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mutational status of the TERTprom region (from −27 to −286 upstream of the ATG), including the rs2853669 polymorphic site, was assessed by PCR amplification and Sanger sequencing. PCR was carried out in a 50 µL volume containing 100 ng of DNA, 5 µL of AmpliTaq Gold 10× buffer, 0.2 mM dNTPs, 1 mM MgCl₂, 0.5 µM of each M13-tailed primer, 10 µL of GC enhancer for sample to amplify, and 1.25 U of AmpliTaq Gold 360 polymerase. The AmpliTaq Gold 360 reagents were purchased from Applied Biosystems (Austin, TX, USA). Primer sequences were previously reported by Heidenreich et al. [17 (link)]. The amplified products were purified with the Illustra GFX 96 PCR Purification Kit (GE Healthcare, Buckinghamshire, UK) and sequenced using Big Dye terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Austin, TX, USA) and Big Dye XTerminator Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) on a 96-capillary sequencer (AB3730xl Genetic Analyzer).

Del Bianco P., Stagni C., Giunco S., Fabozzi A., Elefanti L., Pellegrini S., Vecchiato A., Pigozzo J., Zamuner C., De Rossi A., De Nicolo A, & Menin C. (2020). TERT Promoter Mutations Differently Correlate with the Clinical Outcome of MAPK Inhibitor-Treated Melanoma Patients. Cancers, 12(4), 946.

+ Open protocol

+ Expand

Detecting Fusaricidin Synthase Genes in Paenibacillus

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to detect the presence of a candidate fusaricidin synthetase gene (fusA) in the Paenibacillus endophyte strains, two oligonucleotides (FusAF and FusAR) were designed based on the fusA sequence (GenBank accession #EU184010) using Primer3 software. For fusA amplification, a PCR master mix (20 μl) was made as follows: 50 ng DNA were added (2.5 ng/μl was the final DNA concentration in the PCR reaction), 50 ng DNA, 2.5 μl Standard Taq Buffer (10 ×) (New England Biolabs), 0.5 μl of 25 mM dNTP mix, 0.25 μl of 50 mM MgCl₂, 0.25 μl of Standard Taq (10 U/μl, New England Biolabs), 1 μl of primer FusAF with sequence 5′- AGGCAAGCTTTGACTTGGAA −3′ and 1 μl of primer FusAR with sequence 5′- CGCTTGCTCAGACCATACAA −3′ and double distilled water up to 20 μl total. The PCR amplification conditions were: 96°C for 3 min, followed by 35 amplification cycles (94°C for 30 s, 48°C for 30 s, 72°C for 90 s), and a final extension at 72°C for 7 min, using a PTC200 DNA Thermal Cycler (MJ Scientific, USA). The PCR products were separated on 1.5% agarose gels at ≤ 5 V/cm, then the bands were visualized under UV light; bands were excised and eluted from the gels (Illustra GFX 96 PCR Purification kit, GE Healthcare, USA). The purified DNA was sequenced at the Genomic Facility Laboratory at the University of Guelph. The corresponding gene was identified based on best BLAST matches to Genbank.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!