The FcSUMO and FcUBC9 open reading frame (ORF) genes were amplified by PCR using specific primer pairs rSUMO-F/rSUMO-R and rUBC9-F/rUBC9-R respectively. After confirmation by sequencing, the purified PCR products were cloned into pET-28a vector to obtain the recombinant plasmids (pET-28a-SUMO and pET-28a-UBC9), then transformed into Escherichia coli BL21 (DE3) (Novagen). Positive clones were screened by PCR and confirmed by sequencing, then incubated in LB medium and induced with isopropyl-β-D-thiogalactosidase (IPTG). The recombinant FcSUMO (rSUMO) and FcUBC9 (rUBC9) with 6×His-tag were purified with Ni2+-afinity column (HiTrap HP column, GE) respectively. Subsequently, the purified protein was renatured in TBS glycerol buffer (50 mM Tris-HCl, 50 mM NaCl, 10% glycerol, 6–0 M urea, pH 8.0) by four dialysis steps and each dialysis step was performed at 4°C for 12 h. Finally, the proteins were analyzed by SDS-PAGE and stained with Coomassie brilliant blue R250. The concentration of the two purified proteins was quantified by bicinchoninic acid (BCA) method [21 (link)].
Hitrap hp column
Manufactured by GE Healthcare
Sourced in United States, France
The HiTrap HP column is a chromatography column designed for the purification of proteins. It is made of a high-performance resin that allows for efficient separation and purification of target proteins from complex samples. The column has a high binding capacity and is suitable for a variety of protein purification applications.
Automatically generated - may contain errors
Lab products found in correlation
Pd 10 column, by GE Healthcare (3 mentions)
Sp sepharose column, by GE Healthcare (2 mentions)
Hiload 26 600 superdex 200 column, by GE Healthcare (2 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Pfu dna polymerase, by Thermo Fisher Scientific (1 mentions)
Chelerythrine, by Merck Group (1 mentions)
Biotinylation kit, by Thermo Fisher Scientific (1 mentions)
Bl21 de3, by Toyobo (1 mentions)
Hitrap q, by GE Healthcare (1 mentions)
Superdex 200, by GE Healthcare (1 mentions)
0.22 m filter, by Merck Group (1 mentions)
Vivaspin ultrafiltration unit, by Sartorius (1 mentions)
Ktapurifier 100 system, by GE Healthcare (1 mentions)
Superdex 200 10 300 gl column, by GE Healthcare (1 mentions)
Amicon ultra centrifugal filter, by Merck Group (1 mentions)
Kta purifier 100, by GE Healthcare (1 mentions)
0.22 μm filter, by Merck Group (1 mentions)
Chromogenic limulus amebocyte lysate assay, by Lonza (1 mentions)
Akta pure chromatography system, by GE Healthcare (1 mentions)
20 protocols using hitrap hp column
1
Recombinant SUMO and UBC9 Protein Purification
2
Purification of Mutant PPARγ Fusion Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human PPARγ containing domains from DBD to the C-terminus (CDE domains, residues 103–477) was expressed as an N-terminal 6×His fusion protein (H6-PPARγ CDE) from the expression vector pET24a (Novagen, Germany). 3RA mutant plasmid was constructed by site-directed mutagenesis with forward primer: AGGATGCAAGGGTTTCTTCGCGGCAACAA
TCGCATTGAAGCTTATCTATGACAG, and reverse primer: CTGTCATAGATAAGCTTCA
ATGCGATTGTTGCCGCGAAGAAACCCTTGCATCCT, using Pfu DNA polymerase (Thermo Fisher Scientific, USA). BL21(DE3) cells transformed with the expression plasmids were grown in LB broth at 25°C to an OD600 of approximately 1.0 and induced with 0.1 mmol/L isopropyl 1-thio-β-d -galactopyranoside (IPTG) at 16°C. Cells were harvested and sonicated in 100 ml of extract buffer (20 mmol/L Tris pH8.0, 150 mmol/L NaCl, 10% glycerol, and 25 mmol/L imidazole) per 2 liters of cells. After sonication, the lysate was centrifuged at 20,000 rpm for 30 min, and the supernatant was loaded on a 5-ml NiSO4-loaded HiTrap HP column (GE Healthcare, PA, USA). The column was washed with extract buffer, and the protein was eluted with a gradient of 25 to 500 mmol/L imidazole. The PPARγ CDE was further purified with a SP-Sepharose column (GE Healthcare, PA, USA).
TCGCATTGAAGCTTATCTATGACAG, and reverse primer: CTGTCATAGATAAGCTTCA
ATGCGATTGTTGCCGCGAAGAAACCCTTGCATCCT, using Pfu DNA polymerase (Thermo Fisher Scientific, USA). BL21(DE3) cells transformed with the expression plasmids were grown in LB broth at 25°C to an OD600 of approximately 1.0 and induced with 0.1 mmol/L isopropyl 1-thio-β-
3
Immobilized mTgase for IgG1 Conjugation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 4
To simplify mTgase removal and allow reuse of the enzyme, immobilized mTgase was used in catalysis. In preparing a column of immobilized mTgase, 1 ml of 15 mg/ml of mTgase in carbonate buffer (pH 8.3) was used for each NHS activated HITRAP® HP column of 1.0 ml (GE) following manufacturer's protocol. 0.5 ml of purified IgG1 at 1-10 mg/ml in Tris-buffer (pH 6-8.0) with 1-5 mM of MDC was injected into HITRAP®-mTgase column. The column was sealed at both ends and incubated at 37° C. overnight. The next day, reaction mixture was eluted with Tris buffer. The column was rejuvenated with 1-20 mM TCEP for the next conjugation reaction. There was no loss of activity of immobilized mTgase after each use. Yield of 90% HC was reached at each run, similar to the yield obtained with free mTgase.
4
Purification and Reconstitution of PPARγ LBD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human PPARγ LBD (residues 206–477) was expressed as an N-terminal 6xHis fusion protein from the expression vector pET24a (Novagen, Germany). BL21(DE3) cells transformed with the expression plasmid were grown in LB broth at 25 °C to an OD600 of approximately 1.0 and induced with 0.1 mmol/l isopropyl 1-thio-β-D-galactopyranoside (IPTG) at 16 °C. Cells were harvested and sonicated in 200 ml of extract buffer (20 mmol/l Tris pH 8.0, 150 mmol/l NaCl, 10% glycerol, and 25 mmol/l imidazole) per 6 liters of cells. The lysate was centrifuged at 20,000 rpm for 30 min, and the supernatant was loaded on a 5-ml NiSO4-loaded HiTrap HP column (GE Healthcare, PA, USA). The column was washed with extract buffer, and the protein was eluted with a gradient of 25–500 mmol/l imidazole. The PPARγ LBD was further purified with a SP-Sepharose column (GE Healthcare, PA, USA). To prepare the protein-ligand complex, 5-fold excess of the chelerythrine (Sigma, USA) and 2-fold excess of steroid receptor coactivator 1 (SRC1) peptide (AQQKSLLQQLLTE) were added to the purified protein, followed by filter concentration to 10 mg/ml.
5
Production and Purification of PspA and PspA-C-CPE Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pET16b plasmids encoding PspA or PspA-C-CPE were prepared as previously described11 (link). To obtain recombinant protein, plasmids were transformed into Escherichia coli strain BL21 (DE3) (TOYOBO, Osaka, Japan). To induce the production of PspA or PspA-C-CPE, isopropyl-D-thiogalactopyranoside (Nacalai Tesque, Kyoto, Japan) was added to the culture medium. The culture pellet was sonicated in buffer A (10 mM Tris–HCl [pH 8.0], 400 mM NaCl2, 5 mM MgCl2, 0.1 mM phenylmethylsulfonyl fluoride, 1 mM 2-mercaptoethanol, and 10% glycerol). The supernatant was loaded onto a HiTrap HP column (GE Healthcare, Pittsburgh, Pennsylvania, USA). PspA or PspA-C-CPE protein was eluted with buffer A containing 100 to 500 mM imidazole. The solvent was exchanged with phosphate-buffered saline (PBS) by using a PD-10 column (GE Healthcare). The concentration of recombinant protein was measured by using a BCA Protein Assay Kit (Life Technologies, Carlsbad, California, USA). PspA-C-CPE was biotinylated by using a biotinylation kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA).
6
Immobilized mTgase for IgG1 Conjugation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 4
To simplify mTgase removal and allow reuse of the enzyme, immobilized mTgase was used in catalysis. In preparing a column of immobilized mTgase, 1 ml of 15 mg/ml of mTgase in carbonate buffer (pH 8.3) was used for each NHS activated HITRAP® HP column of 1.0 ml (GE) following manufacturer's protocol. 0.5 ml of purified IgG1 at 1-10 mg/ml in Tris-buffer (pH 6-8.0) with 1-5 mM of MDC was injected into HITRAP®-mTgase column. The column was sealed at both ends and incubated at 37° C. overnight. The next day, reaction mixture was eluted with Tris buffer. The column was rejuvenated with 1-20 mM TCEP for the next conjugation reaction. There was no loss of activity of immobilized mTgase after each use. Yield of 90% HC was reached at each run, similar to the yield obtained with free mTgase.
7
Immobilized mTgase for IgG1 Conjugation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 4
To simplify mTgase removal and allow reuse of the enzyme, immobilized mTgase was used in catalysis. In preparing a column of immobilized mTgase, 1 ml of 15 mg/ml of mTgase in carbonate buffer (pH 8.3) was used for each NHS activated HITRAP® HP column of 1.0 ml (GE) following manufacturer's protocol. 0.5 ml of purified IgG1 at 1-10 mg/ml in Tris-buffer (pH 6-8.0) with 1-5 mM of MDC was injected into HITRAP®-mTgase column. The column was sealed at both ends and incubated at 37° C. overnight. The next day, reaction mixture was eluted with Tris buffer. The column was rejuvenated with 1-20 mM TCEP for the next conjugation reaction. There was no loss of activity of immobilized mTgase after each use. Yield of 90% HC was reached at each run, similar to the yield obtained with free mTgase.
8
Immobilized mTgase for IgG1 Conjugation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 4
To simplify mTgase removal and allow reuse of the enzyme, immobilized mTgase was used in catalysis. In preparing a column of immobilized mTgase, 1 ml of 15 mg/ml of mTgase in carbonate buffer (pH 8.3) was used for each NHS activated HITRAP® HP column of 1.0 ml (GE) following manufacturer's protocol. 0.5 ml of purified IgG1 at 1-10 mg/ml in Tris-buffer (pH 6-8.0) with 1-5 mM of MDC was injected into HITRAP®-mTgase column. The column was sealed at both ends and incubated at 37° C. overnight. The next day, reaction mixture was eluted with Tris buffer. The column was rejuvenated with 1-20 mM TCEP for the next conjugation reaction. There was no loss of activity of immobilized mTgase after each use. Yield of 90% HC was reached at each run, similar to the yield obtained with free mTgase.
9
Overexpression and Purification of STING Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasimids of pET28a-rSTINGCTD, hSTINGCTD, mSTINGCTD and their variants were transformed into Escherichia coli BL21 (DE3) cells for overexpression. Cells were induced at 18 °C with 0.5 mM isopropyl β-d-1-thiogalactopyranoside for 20 hours, then collected and resuspended in buffer A (20 mM Tris-HCl, pH 8.0, 500 mM NaCl). Cells were subjected to ultrasonic lysis and clarified by centrifugation at 21,500 rpm for 90 minutes. Supernatants were loaded onto a HiTrap HP column (GE Healthcare, USA) equilibrated with buffer A. The contaminants were washed with buffer A containing 100 mM imidazole. The target proteins were eluted with buffer A containing 500 mM imidazole. Eluates were further purified by ion-exchange chromatography (HiTrap Q, GE Healthcare) and eluted with a linear sodium chloride gradient. Further purification steps were conducted through gel filtration (Superdex-200; GE Healthcare) equilibrated with 20 mM Tris–HCl, pH 8.0, 200 mM NaCl. Proteins used for crystallization trials were concentrated to 10 mg ml−1.
10
Purification of Recombinant Enzymes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After harvesting cells by centrifugation (2700g for 5 min, 4 °C), the supernatant was adjusted to pH 7.8 just before purification, filtered on 0.22-µm filters (Millipore, Molsheim, France), and loaded onto a 5-mL HiTrap HP column (GE Healthcare, Buc, France) equilibrated with buffer A (Tris–HCl 50 mM pH 7.8, NaCl 150 mM, imidazole 10 mM) that was connected to an Äkta purifier 100 system (GE Healthcare). Each (His)6-tagged recombinant enzyme was eluted with buffer B (Tris–HCl 50 mM pH 7.8, NaCl 150 mM, imidazole 500 mM). Fractions containing recombinant enzymes were pooled and concentrated with a 10-kDa vivaspin ultrafiltration unit (Sartorius, Palaiseau, France) and filter dialyzed against sodium acetate buffer 50 mM, pH 5.2. The concentrated proteins were incubated overnight with an equimolar equivalent of CuSO4 in a cold room and buffer exchanged in 50 mM sodium acetate buffer pH 5.2 using extensive washing in a 10-kDa ultrafiltration unit to remove traces of CuSO4.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!