The largest database of trusted experimental protocols

4 protocols using anti caprin 1

1

Western Blot Antibody Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The nitrocellulose membranes were blocked and antibodies were applied in 5% milk in TRIS-buffered saline/Tween-20 (TBST, 0.1M TRIS-HCl, 0.9% [w/v] NaCl, 0.1% [v/v] Tween-20, pH 7.5). The antibodies used were anti-NF45/ILF2 (Bethyl, A303-147A-M), anti-DHX9 (Bethyl, A300-855A-M), anti-Matrin-3 (Bethyl, A300-591A-M), anti-hnRNPA1 (Novus, NB100-672), anti-Caprin-1 (Proteintech, 15112-1-AP), anti-GST (Santa Cruz, sc-459), anti-DDX3X (Sigma, HPA001648), anti-actin (Santa Cruz, sc-1616), anti-FLAG (Sigma, A8592), anti-Alix (Santa Cruz, sc-49268), anti-TSG101 (GeneTex, GTX70255), anti-CD63 (Santa Cruz, sc-15363), and anti-Histone H3 (Cell Signaling Technology, 9715). The immunoblotting images were acquired with the Chemidoc MP Imaging System (Bio-Rad) and quantified with the Image Lab software (Bio-Rad).
+ Open protocol
+ Expand
2

Labeling De Novo Protein Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
HONE-1 cells were washed with PBS and cultured with methionine-free DMEM (GIBCO-Life Technologies) at 37°C for 1 h prior to the addition of 2 μM tylophorine and 25 μM Click-iT® HPG (L-homopropargylglycine, Invitrogen) and incubation at 37°C for 24 h. The cells were then harvested and subjected to the Click Reaction with 20 μM TAMRA (Tetramethylrhodamine, Invitrogen) for labeling the de novo synthesized proteins in Click-iT® Protein Reaction Buffer according to the manufacturers' protocol (Invitrogen). The resultant cell lysates were immunoprecipitated with anti-caprin-1 (ProteinTech Group), anti-c-Myc (Cell Signaling Technology), anti-cyclin D1, anti-cyclin D2 (Santa Cruz Biotechnology), anti-TAMRA (Thermo Scientific) or GAR (Perkin-Elmer) respectively overnight at 4°C with constant agitation prior to incubation with protein G agarose (Millipore) at 4°C for another 2 h. After washes, the specific immunoprecipitated protein was eluted and analyzed by western immunoblot analysis with the antibody indicated.
+ Open protocol
+ Expand
3

Western Blot Analysis of Viral Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting analyses were performed as described [24 (link)]. Primary antibodies used for western blotting were anti-p-p65 (Ser536) (Cell Signaling, Danvers, MA, USA, 3033), anti-p65 (Cell Signaling, 8242), anti-p-IκBα (Ser32) (Cell Signaling, 2859), anti-IκBα (Cell Signaling, 9242), anti-GAPDH (Cell Signaling, 2118), anti-Caprin-1 (Proteintech, Rosemont, IL, USA, 15112-1-AP), anti-HCoV-OC43-nucleocapsid protein (anti-HCoV-OC43-N) (Merck Millipore, Temecula, CA, USA, Mab9013), and anti-vinculin (GeneTex, Irvine, CA, USA, GTX109749); their correspondent secondary antibodies used were horseradish peroxidase coupled anti-rabbit IgG antibody (PerkinElmer, Boston, MA, USA, NEF812001EA) or horseradish peroxidase coupled anti-mouse IgG antibody (GeneTex, GTX213111-01).
+ Open protocol
+ Expand
4

Quantitative RT-PCR and Western Blot Analysis of mRNA and Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
For mRNA analysis, total RNA extraction for cDNA synthesis was conducted with the Taqman Reverse Transcription Reagent kit (TaKara-Bio, Kusatsu, Japan). Real-time quantitative PCR was conducted with different primer sequences (Table 1) using SYBR Green Master Mix (TaKaRa).

Primer sequences for real time RT-PCR

TargetForwardReverse
ACTBTCTTCCAGCCTTCCTTCCTAGCACTGTGTTGGCGTACAG
CAPRIN1TCTCGGGGTGATCGACAAGAACCCTTTGTTCATTCGTTCCTGG
SLC2A1TGTCTGGCATCAACGCTGTCTTCTC CCTGCTCGCTCCACCACAAAC
HK2CGACAGCATCATTGTTAAGGAGCA GCAGGAAAGACACATCACATTT
HIF1AAGTTCCGCAAGCCCTGAAAGCGCAGTGGTAGTGGTGGCATTAGC
MYCCGCCTCTTGACATTCTCCTCGGACTATCCTGCTGCCAAGA
NUP160GTTATCTGGCTGCTCTCAATTGGTGCATTCTCCATCATGATTCC
NUP133AGTACCTGTGGGCTGCTTCTCTAGGCTCTGGTTGTCAGTCTGCTCAC
NUP155CCGCTCCTCAGTCTCCCAGTGGCTCATCCTTGGATCGCTGTGAC
METTL3CCAGCACAGCTTCAGCAGTTCCGCGTGGAGATGGCAAGACAGATG
WTAPCTGACAAACGGACCAAGTAATGAAAGTCATCTTCGGTTGTGTTG
Proteins were separated by SDS–PAGE followed by Western blot as described previously [30 (link), 31 (link)]. Anti- GAPDH (Cell Signaling Technology), anti-Caprin-1 (116 kDa, ProteinTech Group), anti-HIF1α (120 kDa, ProteinTech Group), anti-c-Myc (49 kDa, roteinTech Group), anti-WTAP (45 kDa, Santa Cruz Biotechnology), and anti-METTL3 (64 kDa, Abcam) were used as primary antibodies. HRP-conjugated anti-mouse and anti-rabbit IgG (Cell Signaling Technology) were used as secondary antibodies.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!