Rneasy total rna extraction kit

Total RNA was isolated from cultured melanoma cells using RNeasy total RNA extraction kit (Qiagen, Valencia, CA). First-strand DNA was synthesized using Super Script III reverse transcriptase (Invitrogen, Grand Island, NY). Chemokines and receptors were amplified using the following primers: CXCL1 forward 5’- AGGGAATTCACCCCAAGAAC-3’ and reverse 5’- TGGATTTGTCACTGTTCAGCA -3’; CXCL8 forward 5’-ATGACTTCCAAGCTGGCC-3’ and reverse 5’-CAGACAGAGCTCTCTTCC-3’; CXCR1 forward 5’- AGGGGCCACACCAACCTTCTG -3’ and reverse 5’- AGTGCCTGCCTCAATGTCTCCA 3’; CXCR2 forward 5’- CAGTTACAGCTCTACCCTGCC -3’ and reverse 5’-CCAGGAGCAAGGACAGACCCC- 3’. Amplification of β-Actin was used as a loading control.

The cultured cells were washed twice with Dulbecco's phosphate-buffered saline (Sigma-Aldrich, St Louis, MO, USA) before the isolation of total RNA. RNA extraction was carried out using the RNeasy total RNA extraction kit (QIAGEN, Hilden, Germany) as per the manufacturer's guidelines. To quantify the gene expression levels, qPCR was performed using 8 ng of total RNA, following reverse transcription with the High Capacity RNA-to-cDNA kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. The QuantStudio 7 Flex Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) was used to measure gene expression levels, and primers and probe sets were utilized to detect each gene transcript, as listed in Table 3. The expression levels of the genes are presented relative to RNAs derived from a human small intestine (R1234226-50, BioChain Institute, Inc., Newark, CA, USA).Table 3

Primers used for qRT-PCR

Gene Symbole	Assay ID
CYP1A1	Hs01054797_g1
CYP1A2	Hs00167927_m1
CYP2B6	Hs04183483_g1
CYP2C9	Hs00426397_m1
CYP2C19	Hs00426380_m1
CYP2D6	Hs00164385_m1
CYP3A4	Hs00430021_m1
VDR	Hs00172113_m1
PXR	Hs00243666_m1
AHR	Hs00169233_m1
GR	Hs00230813_m1
P-gp	Hs00184500_m1
BCRP	Hs01053790_m1
PEPT1	Hs00192639_m1
OATP2B1	Hs01030343_m1
MRP2	HS00960489_m1
MRP3	Hs00978452_m1

Total RNA was extracted from cells using an RNeasy Total RNA Extraction kit (Qiagen, Valencia, CA, USA) along with on-column DNase I treatment. RNA quality was analyzed using a Bioanalyzer 2100 (Agilent Technologies Inc., Santa Clara, CA, USA). RNA samples that had RNA integrity number values above 9.8 were considered acceptable.

Cultured cells were washed twice with Dulbecco’s phosphate-buffered saline (Sigma–Aldrich, St Louis, MO, USA). Total RNAs were isolated from cells by using the RNeasy total RNA extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

Total RNA extracted using the RNeasy total RNA extraction kit (Qiagen) was treated with RNase-free DNase (Qiagen) and then reverse transcribed with High Capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer’s instructions. cDNA was subjected to quantitative real-time PCR on ABI 7000 sequence detection system (PE Applied Biosystems, Warrington, United Kingdom) by using SYBR green PCR master mix (Applied Biosystems). Primers used for quantitative real-time reverse transcription-PCR (qRT-PCR) were IRF-1 forward primer 5′-AGCTCAGCTGTGCGAGTGTA-3′ and reverse primer 5′-CATGACTTCCTCTTGGCCTT-3′ and Tat/Rev forward primer 5′-CTTAGGCATCTCCTATGGCAGGAA-3′ and reverse primer 5′-GGATCTGTCTCTGTCTCTCTCTCCACC-3′. Transcript levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward, 5′-GGGTGTGAACCATGAGAAG-3′; reverse, 5′-GCTAAGCAGTTGGTGGTGC-3′) as an internal control and expressed as fold increase according to the ΔC_T methods (means ± standard deviations).

Three-week-old male TSOD (Tsumura, Suzuki, Obese, Diabetes) mice and TSNO (Tsumura, Suzuki, Non-Obesity) mice were purchased from the Institute for Animal Reproduction (Ibaraki, Japan). Mice were housed in groups of two or three per cage, maintained at 24±2 °C on a 12-hour light and 12-hour dark cycle, and given normal chow diet (MF; Oriental Yeast Co., Ltd., Tokyo, Japan) and water ad libitum. Nonfasting blood glucose concentrations in tail vein blood and body weights were measured in 3-, 4-, 5-, 6-, and 7-week-old TSOD and TSNO mice. After measurements, the mice in each group were dissected to collect epididymal white adipose tissue under anesthesia to minimize suffering. Regarding each adipose tissue sample of individual mice, the total RNA was extracted using the RNeasy Total RNA Extraction kit (Qiagen, Valencia, CA, USA). The numbers of samples taken for subsequent analyses are shown in Supplementary Table S1. This animal study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of University of Toyama. The protocol was approved by the Committee on the Ethics of Animal Experiments of the University of Toyama.

Cultured cells were washed twice with PBS, and total RNA was isolated from the cells using the RNeasy Total RNA Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.