The whole genomic sequence of BAK1 without the stop codon was PCR amplified using the primers described in Supplementary Table S1 and recombined into the pDONR207 (Invitrogen). The full length ER is unstable under the control of a strong promoter (Shpak et al., 2003 (link); Karve et al., 2011 (link)) and therefore it was required to construct a truncated kinase version, ΔKinase, to enhance protein expression levels. The truncated ERΔKinase version was also generated by PCR (Supplementary Table S1 ) with a stop codon after the transmembrane domain at amino acid position 615 and cloned into the pDONR207. All the PCR products were fully sequenced before proceeding with the next cloning steps. The BAK1 and ERΔKinase products were recombined into the pGWB14 and pGWB5 plasmids (Nakagawa et al., 2007 (link)) to generate C-terminal HA and C-terminal GFP fusion constructs under the control of the 35S::CaMV promoter using the Gateway recombination technology (Invitrogen). These vectors were verified by restriction analysis and transformed into Agrobacterium tumefaciens strain AglI.
Gateway recombination technology
Manufactured by Thermo Fisher Scientific
Sourced in United States
Gateway recombination technology is a molecular cloning method that enables rapid and efficient transfer of DNA sequences between multiple vector systems. It relies on site-specific recombination reactions to move DNA fragments between entry and destination vectors, facilitating the construction of expression clones. The core function of this technology is to provide a flexible and high-throughput approach for gene cloning and protein expression.
Automatically generated - may contain errors
Lab products found in correlation
Plix 402, by Thermo Fisher Scientific (2 mentions)
Plko 1 shslfn5 plasmids rhs4533 eg162394, by Horizon Discovery (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Pcr8 gw topo vector, by Thermo Fisher Scientific (2 mentions)
Pcmv 2xmyc dest, by Thermo Fisher Scientific (2 mentions)
P3xflag hd dest, by Thermo Fisher Scientific (2 mentions)
Homo sapiens vps54 cdna, by OriGene (2 mentions)
Pegfp n1, by Takara Bio (2 mentions)
Pdonr207, by Thermo Fisher Scientific (1 mentions)
Kanamycin, by Merck Group (1 mentions)
Pentr d topo cloning vector, by Thermo Fisher Scientific (1 mentions)
Pegfp c2, by Takara Bio (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Virapower packaging mix, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Lr cloning, by Thermo Fisher Scientific (1 mentions)
Quikchange site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Plenti6 v5 dest, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Biowest (1 mentions)
30 protocols using gateway recombination technology
1
Cloning of BAK1 and ERΔKinase
2
Generation of Arabidopsis Plants Overexpressing NDC1-YFP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plants overexpressing NDC1-YFP under the 35S promoter were obtained using the Gateway recombination technology (Invitrogen): The NDC1 coding sequence was introduced into a donor vector pDONR™221, and subsequently transferred into an appropriate destination vector, the pEarlyGate101-YFP binary vector, resulting in pEarlyGate101-NDC1-YFP. pEarlyGate101-NDC1-YFP was transferred into Arabidopsis WT plants using the floral dip method (Clough and Bent, 1998 (link)). Transformed plants were selected for BASTA resistance and confirmed by segregation analysis.
3
Gateway Cloning of SmMyb1 in pGWB411
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SmMyb1 cds was Pfu amplified with primers designed for pENTR-D-TOPO cloning vector (Life Technologies, Carlsbad, CA, USA). SmMyb1 gene from the entry clone was cloned in the 35SCaMV expression cassette of pGWB411 (Nakagawa et al., 2009 (link)) using the Gateway recombination technology (Invitrogen, Carlsbad, CA, USA). Spectinomycin positive colonies were sequenced and used to transform Agrobacterium tumefaciens LBA4404.
Nicotiana benthamiana plants were grown until they had six leaves and the youngest leaves over 1 cm long were infiltrated with A. tumefaciens LBA4404. Bacteria were cultured on Lennox agar (Life Technologies, Carlsbad, CA, USA) supplemented with 50 μg ml-1 kanamycin (Sigma–Aldrich, St. Louis, MO, USA) and incubated at 28°C. A 10 μl loop of confluent bacteria were re-suspended in 10 ml of infiltration media (10 mM MgCl2, 0.5 μM acetosyringone), to an OD600 of 0.3, and incubated at room temperature without shaking for 2 h before infiltration. Infiltrations were performed according to the method of Voinnet et al. (2003) (link). Approximately 300 μl of the Agrobacterium suspension were infiltrated into a young leaf of N. benthamiana and transient expression was assayed 5 days post inoculation.
Nicotiana benthamiana plants were grown until they had six leaves and the youngest leaves over 1 cm long were infiltrated with A. tumefaciens LBA4404. Bacteria were cultured on Lennox agar (Life Technologies, Carlsbad, CA, USA) supplemented with 50 μg ml-1 kanamycin (Sigma–Aldrich, St. Louis, MO, USA) and incubated at 28°C. A 10 μl loop of confluent bacteria were re-suspended in 10 ml of infiltration media (10 mM MgCl2, 0.5 μM acetosyringone), to an OD600 of 0.3, and incubated at room temperature without shaking for 2 h before infiltration. Infiltrations were performed according to the method of Voinnet et al. (2003) (link). Approximately 300 μl of the Agrobacterium suspension were infiltrated into a young leaf of N. benthamiana and transient expression was assayed 5 days post inoculation.
4
Generating Fluorescent FMRP Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GFP-FMRP was obtained by subcloning the isoform 1 of the human FMR1 sequence into the EcoR1/Pst1 site of the mammalian expression vector pEGFP-C2 (Clontech). GFP-/Dendra2-/GST-/His-FMRP mutant constructs were all made by site-directed mutagenesis using the Quick-change mutagenesis solution (Agilent). pSinRep5 constructs used to produce Sindbis particles were generated using the Gateway recombination technology (Invitrogen). All constructs were then entirely sequenced.
5
Transgenic C. elegans line creation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A destination vector, pPD117.01GtwyB(Asp718), was kindly provided by Barth D. Grant (Rutgers University, Piscataway, NJ) and contained a Gateway cassette B upstream of GFP. The mec-7 promoter of pPD117.01GtwyB(Asp718) was replaced by the act-5 promoter (pKS17). The cDNA fragment of ifo-1 was cloned into pKS17 using Gateway recombination technology (Invitrogen). A transgenic line (dkIs749[Pact-5-ifo-1-GFP; unc-119(+)]) was created using the microparticle bombardment method as described previously (Praitis et al., 2001 (link)). For a selection marker, the wild-type unc-119 fragment was introduced simultaneously.
6
Synthesis of BKV Pseudoviruses
7
Molecular Cloning of DNJ-17 in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Molecular biology was performed following standard methods. Gateway recombination technology (Invitrogen, CA) was used for expression vectors. Table S2 describes the details of constructs generated in this study. We amplified 3.5 kb genomic sequences of dnj-17 with 0.9 kb 5′ upstream sequences to 0.1 kb 3′ downstream region using the following primers: YJ11121 AAACTCCATCAACCTGACTTCCCTG and YJ11122 TTGCCCATTATTCTTCCCGAAAC. To determine the gene structure of dnj-17 , we isolated mRNAs from mixed-stage animals of N2 wild type and CB156 unc-25 (e156 ) dnj-17 (ju1162 ) using Trizol (ThermoFisher Scientific). Complementary DNA (cDNA) synthesis was performed using SuperScript III (ThermoFisher Scientific), with random primers according to the manufacturers’ instructions. We performed RT-PCR using SL1 primer GTTTAATTACCCAAGTTTGAG and a reverse primer p3 GCGACCAGATTCCTAATTTGCTCGTTC designed on the junction of exon 3 and exon 4 to determine the first exon of dnj-17 mRNA, and p2 ATGAAATGCCATTACGAAGTGCTC and p4 AATGTTTCACCAATCCTCATCATCC primers designed on the first and sixth exon to verify the coding sequence. Sequences of all clones were verified by Sanger sequencing. Protein domain analysis was performed using NCBI domain database (Marchler-Bauer et al. 2015 (link)) and Treefam (Li et al. 2006 (link)).
8
Lentiviral Transduction of miR-BART9 in NPC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A double-stranded oligonucleotide with a sequence corresponding to the miR-BART9 precursor was synthesized and inserted into the pcDNA6.2-GW/EmGFP-miR vector under control of the CMV promoter. The cloning primers used here are listed in Table S1 . Following confirmation via sequencing, the miR-BART9 expression vector was transferred to a lentiviral expression plasmid (pLenti6/V5-DEST) using Gateway recombination technology (Invitrogen) according to the manufacturer's instructions. Then, lentivirus was produced in HEK293-FT packaging cells by co-transfecting the miR-BART9 expression plasmid or control (LacZ) plasmid with packaging vectors (ViraPower packaging mix, Invitrogen) using Lipofectamine 2000 (Invitrogen). Lentivirus was harvested from clarified culture supernatants 48 hr after transfection and NPC cells were transduced overnight in the presence of 4 µg/mL of polybrene.
9
C. elegans Strain Generation and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C. elegans strains were grown at 22.5°C following standard procedures. Supplementary file 1 lists all the strains and transgene information. Whole-genome sequence analysis of CZ21292 lgc-46(ju825); acr-2(gf) was performed using Galaxy platform (Giardine et al., 2005 (link)). Molecular biology was performed following standard methods. Gateway recombination technology (Invitrogen, CA) was used for generating expression constructs. Supplementary file 2 describes the details of DNA constructs generated in this study. The promoters used are: Prgef-1 for pan-neuronal (Altun-Gultekin et al., 2001 (link)), Pmyo-3 for body muscles (Okkema et al., 1993 (link)). Pitr-1 for DA9 neuron (Klassen and Shen, 2007 (link)).
10
Grapevine and Arabidopsis Transformation Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid pHellsgate2 was utilized to construct the RNA silencing vector for VvMADS28 based on gateway recombination technology (Invitrogen). When grapevine plants were flowering, infiltration was performed by submerging an inflorescence into the Agrobacterium suspension and applying a vacuum for 10 minutes. The same plants were subjected to transformation once a week for 4 weeks.
The overexpression vector pCAMBIA2300-flag-VvMADS28 was created and introduced into Agrobacterium tumefaciens strain GV3101 as elaborated previously [13 ]. Tomato (‘Micro-Tom’) plants were subjected to transformation by the cotyledon disk method [11 , 43 ].
For heterologous expression in transgenic arabidopsis, VvMADS5/VvERF98/VvWUS coding sequences were engineered into the pCAMBIA2300-GFP vector. Transformation of arabidopsis used the floral dip method [44 (link)]. Seeds were collected after the transformed plants matured and screened on nutrient agar medium containing 50 mg/l kanamycin. T3 plants were used for characterization.
The overexpression vector pCAMBIA2300-flag-VvMADS28 was created and introduced into Agrobacterium tumefaciens strain GV3101 as elaborated previously [13 ]. Tomato (‘Micro-Tom’) plants were subjected to transformation by the cotyledon disk method [11 , 43 ].
For heterologous expression in transgenic arabidopsis, VvMADS5/VvERF98/VvWUS coding sequences were engineered into the pCAMBIA2300-GFP vector. Transformation of arabidopsis used the floral dip method [44 (link)]. Seeds were collected after the transformed plants matured and screened on nutrient agar medium containing 50 mg/l kanamycin. T3 plants were used for characterization.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!