The largest database of trusted experimental protocols

Firescript rt cdna synthesis kit

Manufactured by Solis BioDyne
Sourced in Estonia

The FIREScript RT cDNA Synthesis Kit is a laboratory product designed for reverse transcription of RNA to cDNA. It contains the necessary components, including a reverse transcriptase enzyme, to facilitate this process.

Automatically generated - may contain errors

21 protocols using firescript rt cdna synthesis kit

1

Quantitative Real-Time PCR Analysis of Rat Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
10 mg rat liver or soleus muscle was extracted for total RNA using an RNA extraction kit (FavorPrepTM Blood/Cultured Cell Total RNA Purification Mini Kit, Favorgen Biotech, Ping-Tung, Taiwan) and transcribed to cDNA using the FIREScript RT cDNA Synthesis KIT (Solis Bio-Dyne, Tartu, Estonia) with oligo (dT) 18 primer following manufacturer’s instructions. For real-time PCR, samples of cDNA were triplicate analyzed using the 5× HOT FIREPol® EvaGreen® qPCR Mix Plus (Solis Bio-Dyne, Tartu, Estonia) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The levels of relative mRNA were analyzed and normalized to β-actin (Actb), used as an endogenous control gene. The final concentration of primers in the reaction was 250 nM, and their sequences are presented in Table 1. Thermal cycling for PCR was as follows: activation of 94 °C for 15 min, followed by 40 cycles of amplification at 94 °C for 15 s, 54–59 °C for 20 s, and 72 °C for 27 s.
+ Open protocol
+ Expand
2

SARS-CoV-2 Viral Load and Cytokine Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from lung homogenate using TRIzol LS (ThermoFisher) and subjected to qRT-PCR using the KAPA PROBE FAST One-Step kit (Roche, Basel, Switzerland) with primers and probes specific for the SARS-CoV-2 N and E genes, and γ-actin (housekeeping gene). To examine the cytokine responses, RNA was isolated from lung homogenates or splenocytes as described above. cDNA was synthesized using the FIREScript® RT cDNA synthesis KIT (Solis BioDyne, Tartu, Estonia) and subjected to the qPCR with gene-specific primers and SYBR green dye to determine the quantification cycle (Cq). All reactions were detected using the Applied Biosystems QuantStudio 6 and 7 Flex Real-Time PCR Systems. Relative RNA expression level was calculated using the ΔΔCq method with γ-actin as an internal control. The primer sequences used in the study are listed in the Supplementary Methods.
+ Open protocol
+ Expand
3

SYBR Green qRT-PCR for Viral RNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Real time qRT-PCR using SYBR green dye was used to simultaneously amplify and quantify viral RNA. For cDNA preparation, FIREScript® RT cDNA synthesis KIT was used that was purchased from SOLIS BIODYNE (Catalog number 06–15-0000S)0.6 µl of each viral sample, 43 µl of master mix and 1.2 µl of reverse transcriptase enzyme was mixed in single PCR tube. Two standards of known concentration, one lower and one upper limit, were used to determine the viral load of the samples. A plot was generated after the viral concentration was compared with standard curve, which provided the starting quantity of the template molecule on x-axis against the CT (Cycle Threshold) on Y-axis. The PCR conditions included initial denaturation at 95 °C for 5 min, annealing at 65 °C for 60 min, and extension at 72 °C for 10 min.
+ Open protocol
+ Expand
4

RNA Extraction, cDNA Synthesis, and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from cell pellets using the QIAGEN RNeasy Kit (QIAGEN, 74106). cDNA was synthesized using the FIREScript RT cDNA Synthesis Kit (Solis BioDyne, 06-15-00200); then, qRT-PCR was conducted on a ViiA 7 system (Applied Biosystems) with the HOT FIREPol EvaGreen qPCR master mix (Solis BioDyne, 08-24-00020). Gene cycle thresholds were calculated using triplicate replicates and normalized to housekeeping controls. See table S6 for primer list and sequences.
+ Open protocol
+ Expand
5

Quantitative RT-PCR for Yeast mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
For quantification of mRNA levels, total RNA was isolated from yeast cultures. To that end, cells equivalent to an OD600 of 3 were harvested at indicated time points and resuspended in 1 ml of TRIzol reagent (Thermo Fisher Scientific). Approximately 200 μl of glass beads (500 μm diameter) were added and cells were mechanically lysed in three cycles of 1 min. Subsequent steps were performed as described in the manufacturer’s manual. RNA integrity was visualized by agarose-gel electrophoresis (adapted from Aranda et al., 2012 (link)). Residual DNA was removed with the DNA-free Kit (Ambion) and the RNA concentration was determined with a NanoDrop 1000 Spectrophotometer. Reverse transcription of 3.5 μg isolated RNA was performed with the FIREScript RT cDNA synthesis kit (Solis Biodyne) using the supplied random hexamer primers. After dilution of the resulting cDNA, q-RT-PCR was performed with the 5× HOT FirePol EvaGreen qPCR Supermix (Solis Biodyne). All primers used for q-RT-PCR are listed in Supplementary Table S1. All primers showed an efficiency between 90% and 110%, as assessed with standard curve experiments. To measure gene expression levels, cDNA was utilized in duplicate for q-RT-PCR and the relative gene expression levels were calculated with the comparative CT method (Livak and Schmittgen, 2001 (link)) with normalization to UBC6 as housekeeping gene.
+ Open protocol
+ Expand
6

Quantifying DENV Expression in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from mouse tissue using QIAzol lysis reagent (Qiagen, Hilden, Germany) and subsequently used as template for cDNA synthesis using the FIREScript® RT cDNA synthesis KIT (Solis BioDyne, Tartu, Estonia). cDNA was then used as template in the quantitative-polymerase chain reaction (qPCR) with gene-specific primers and SYBR green dye to determine quantification cycle (Cq) using the Applied Biosystems QuantStudio 6 and 7 Flex Real-Time PCR Systems. Relative DENV expression level was calculated using the ΔΔCq method with cyclophilin A (CPH) cDNA as an internal control. The primer sequences used in the study were: CPH forward 5’-atggtcaaccccaccgtgt-3’, reverse 5’-ttcttgctgtctttggaactttgtc-3’; DENV forward 5’-gactagcggttagaggagacccct-3’, reverse 5’-tcccagcgtcaatatgctgttt-3’.
+ Open protocol
+ Expand
7

Quantifying Gene Expression in MCF-7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from MCF-7 cells using the RNeasy Mini kit (Qiagen, Valencia, CA, USA). cDNA was produced from 1.8 μg of total RNA by FIREScript RT cDNA Synthesis KIT (Solis BioDyne, Tartu, Estonia) using random primers following manufacturer's protocol. Real-time quantitative PCR was performed with 5x HOT FIREPol® EvaGreen® qPCR Supermix kit (Solis BioDyne, Tartu, Estonia) using StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA). The cycling protocol was as follows: Initial activation at 95 °C for 12 min, followed by 40 cycles at 95 °C for 15 s, annealing at 53 °C for 30 s, elongation at 72 °C for 30 s. GAPDH was used as the reference gene, and fold change in gene expression was calculated making use of the comparative CT (2−ΔΔCT) method. The relative mRNA abundance was determined by the ratio of the sample to control. Primers for tested genes were as follows: Calmodulin: forward 5′-GGCATTCCGAGTCTTTGACAA-3′ and reverse 5′-CCGTCTCCATCAATATCTGCT-3′, S100A8: forward 5′-GGGATGACCTGAAGAAATTGCTA-3′ and reverse 5′-TGTTGATATCCAACTCTTTGAACCA-3′, S100A14: 5′-GTCGGTCAGCCAACGCAGAG-3′ and reverse 5′-CAGGCCACAGTTGCTCGG-3′, P21: forward 5′-CATGTGGACCTGTCACTGTCTTGTA-3′ and reverse 5′-GAAGATCAGCCGGCGTTTG-3′, and GAPDH: forward 5′-AAGGCTGGGGCTCATTTGCA-3′ and reverse 5′-ATGACCTTGCCCACAGCCTT-3’.
+ Open protocol
+ Expand
8

Quantifying lncRNA Expression in Schizophrenia

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from venous blood of enrolled individuals using Hybrid-RTM blood RNA extraction Kit (GeneAll Biotechnology Co. Ltd., Seoul, South Korea). The quality and quantity of RNA was appraised using Nanodrop equipment (Thermo Scientific, MA, USA). Subsequently, cDNA was produced using FIREScript RT cDNA Synthesis Kit (Solis BioDyne, Estonia). Relative expressions of lncRNAs were assessed in patients with schizophrenia and controls using RealQ Plus Master Mix Green (AMPLICON, Denmark) in the rotor gene 6000 Real-Time PCR System (Corbett, Australia). B2M gene was used as the normalizer. The sequences of primers and amplicon lengths are shown in Table 1.

Sequences of primers used in the study.

Primer NameSequencePrimer LengthPCR Product Length
MEG3-FTGGCATAGAGGAGGTGAT18111
MEG3-RGGAGTGCTGTTGGAGAATA19
SPRY4-IT1-FAGCCACATAAATTCAGCAGA20115
SPRY4-IT1-RGATGTAGGATTCCTTTCA18
HOXA-AS2-FCCCGTAGGAAGAACCGATGA2070
HOXA-AS2-RTTTAGGCCTTCGCAGACAGC20
Linc-ROR-FTATAATGAGATACCACCTTA20170
Linc-ROR-RAGGAACTGTCATACCGTTTC20
UCA1-FCTTAGGCTGGCAACCATCAGATCC24129
UCA1-RGTGTTGTCCTGCATGCTGGTCTG23
MALAT1-FGACGGAGGTTGAGATGAAGC2084
MALAT1-RATTCGGGGCTCTGTAGTCCT20
B2M-FAGATGAGTATGCCTGCCGTG20105
B2M-RGCGGCATCTTCAAACCTCCA20
+ Open protocol
+ Expand
9

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cell pellets using the RNeasy Mini Kit (Qiagen, Cat. No. 74106). RNA quality and concentrations were determined by Nanodrop (Thermo Scientific) spectrophotometric measurements. cDNA synthesis was performed from 300ng of RNA using the FIREScript RT cDNA Synthesis Kit (Solis Biodyne, Cat. No. 06-15-00050) in the Veriti Thermal Cycler (Applied Biosystems). qRT-PCR reactions were set up using the 5x Hot FirePol EvaGreen qRT-PCR SuperMix (Solis Biodyne, Cat. No. 08-36-00001) in QuantStudio 3 Real-Time PCR System (Applied Biosystems). The primers used are listed in Table 1. Gene expression was analyzed using the Comparative CT (ΔΔ CT) method after normalization to the housekeeping gene 18s rRNA. All results are presented as fold expression change compared to non-asthmatic healthy controls.
+ Open protocol
+ Expand
10

cDNA Synthesis from RNA Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cDNA was synthesized using a FIREScript RT cDNA synthesis kit (Solis Biodyne, Tartu, Estonia) as previously documented [29 (link),31 (link),32 (link)]. Briefly, the 20 μL reaction was prepared by adding 500 ng of the RNA sample, 100 μM oligo (dT) primers (1 μL), 10 × RT buffer (2 μL), reverse transcriptase (RT; 1 μL), dNTP Mix (0.5 μL), 40 U/μL RNase inhibitor (0.5 μL), and then RNase-free water. The conditions for converting cDNA were as follows: an initial annealing step at 25 °C for 5 min, followed by a reverse transcription step at 45 °C for 15 min, and an RT inactivation step at 85 °C for 5 min. The concentration of cDNA was quantified before further analysis.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!