Total RNA was extracted using miRNeasy_Mini RNA Extraction Kit (Qiagen, Hamburg, Germany) according to the manufacturer's procedures and stored at −80°C until use. cDNA was synthesized with miScript II RT Kit (Qiagen, Hamburg, Germany). The expression levels of miRNA-124 were determined using the SYBR Green Master Mix Kit (Ampliqon, Odense, Denmark), and the expression levels of potential miRNA-124 targets, STAT-3, SP-1, and SOCS5, were conducted by applying SYBR green Master Mix on a Rotor-Gene Q real-time PCR machine (Qiagen, Hamburg, Germany). The expression levels of STAT-3, SOCS5, and SP1 were normalized to the GAPDH gene, and miR-124 expression was normalized to U6 snRNA as an endogenous control by using 2−ΔΔCt method. The gene-specific primer sets for STAT-3, SOCS5, and SP1 and GAPDH as a housekeeping gene were designed using the NCBI Primer-Blast Tool. The primer mix of U6 and miR-124 was provided from Exiqon (Vedbaek, Denmark). All results are representative of three independent experiments.
Sybr green master mix kit
Manufactured by Ampliqon
Sourced in Denmark
The SYBR Green Master Mix Kit is a reagent solution designed for quantitative real-time PCR (qPCR) analysis. It contains all the necessary components, including SYBR Green I dye, required for the detection and quantification of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (2 mentions)
Rotor gene q real time pcr machine, by Qiagen (1 mentions)
Miscript 2 rt kit, by Qiagen (1 mentions)
Macsquant analyser 10, by Miltenyi Biotec (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Rest software, by Qiagen (1 mentions)
First strand cdna synthesis kit, by Biofact (1 mentions)
7 protocols using sybr green master mix kit
1
Quantifying miRNA-124 and Targets
2
Gene Expression Analysis of Candida Virulence
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed using the SYBR Green master mix kit (Ampliqon; Denmark) and primers for housekeeping genes (ACT1-alb, ACT1-gla, rrsD-Ecoli) and putative virulence genes (Hwp1, Als3, Epa1, Epa6, LuxS, Pfs) as listed in Table 1 . The validity of each primer was confirmed by comparing its corresponding sequence with the database using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/ ) [47 (link)]. Real-time PCR was performed as follows: initial denaturation step at 94 °C for 2 min, followed by 40 cycles of denaturation at 94 °C for15 s, primer annealing at 54 °C for 30 s and extension at 72 °C for 30 s. All samples were performed in triplicate for verification. Gene expression analysis was carried out using the 2-ΔΔCT method [48 (link)].
3
Quantitative Gene Expression Analysis of luxS and pfs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The real-time process was performed using the SYBR Green master mix kit (Ampliqon; Denmark) and primers as described previously (Table 2 ). Quantitative gene expression of luxS and pfs was determined using real-time qRT-PCR according to the following cycle protocol: 4 min at 95 °C (denaturation) for 40 cycles, 15 s at 95 °C, 30 s at 56 °C, and 30 s at 72 °C. The rrsD gene was used as the reference gene. All the samples were analyzed in triplicate and, finally, relative gene expression analysis was performed using the 2−ΔΔCT method [74 (link)].
Primers used in present study [75 (link)]
| Product size (bp) | Primer | |
|---|---|---|
| 196 | 5′-ATACCGCATAACGTCGCAAG-3′ | rrsD |
| 5′-ATATTCCCCACTGCTGCCTC-3′ | ||
| 197 | 5′-AATCACCGTGTTCGATCTGC-3′ | luxS |
| 5′- GCTCATCTGGCGTACCAATC-3′ | ||
| 83 | 5′-ATCGTTGTCTCGGACGAAGC-3′ | pfs |
| 5′-GGACAGCCTGGTAACTGACCG-3′ |
4
Validating miR-365a-3p Exosomal Delivery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A FAM dye-labeled miR-365a-3p was used to validate the entrance of miR into the exosomes. For this purpose, 15 μg of exosomes and exosomes-loaded miR-365a-3p mimic (ExomiR-365a-3p) were diluted in 2 ml PBS and analyzed by flow cytometry (MACSQuantAnalyser 10, Miltenyi Biotech, Germany) and FlowJo software. Moreover, the loading efficiency of the miR-365a-3p mimic in the exosomes was evaluated by real-time PCR in which miR-365a-3p expression was compared in unloaded and miR-loaded exosomes. Total miRNA was extracted using a miRNA isolation kit (Yekta Tajhiz Azama, Tehran, Iran) according to the manufacturer's instructions and stored at −80 °C. The synthesis of cDNA was conducted using a commercial kit (Yekta Tajhiz Azama, Iran). Next, miR-365a-3p expression levels were determined using an SYBR Green Master Mix Kit (Ampliqon, Odense, Denmark) and then normalized to U6 snRNA as an endogenous control. The 2−ΔΔCt method was employed for analysis of the results.
5
Quantifying Gene Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from each group using Trizol reagent (Invitrogen Inc., USA), according to the product's instructions. To quantify RNA, a spectrophotometer (NanoDrop Technologies, USA) was used to measure the absorbance at 260 nm and 280 nm wavelengths. Complementary DNA (cDNA) were synthesized using extracted RNA as template, relative forward and reverse primers, and reverse transcriptase kit according to the manufacturer’s instructions (Yekta Tajhiz Azma, Iran). Real-time quantitative PCR (qRT-PCR) was performed on PCR Rotor-Gene Q real-time PCR Detection System (Qiagen, Hamburg, Germany) using the standard SYBR Green Master Mix Kit (Ampliqon, Odense, Denmark). GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) served as the housekeeping gene. Each sample was performed in triplicate. Primers were as follows, presented in 5′–3′ orientation: HGF-F (AGACCAATGTGCTAATAGATGTA), HGF-R (GCAGTTTCTAATGTAGTCTTTGT), IL-6-F (AACCTGAACCTTCCAAAGATGG), IL-6-R (TCTGGCTTGTTCCTCACTACT), and TGF-β-F (AACCCACAACGAAATCTATGAC), TGF-β-R (TAACTTGAGCCTCAGCAGAC). Statistics were performed on Ct using REST software (Version V2.0.13, Qiagen, Hilden, Germany).
6
Beclin-1, FAS, SREBP-1c, LC3 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was used to analyze the expression of the Beclin-1, FAS, SREBP-1c, and LC3 genes. Que (1 and 5 μM) was administered alone and with metformin (0.25 mM) to PA-induced HepG2 cells. RNA was extracted using the RNeasy mini kit (Qiagen, Germany), and cDNA was produced by reverse transcription of the RNA (Bio FACT, Daejeon, South Korea). The SYBR Green Master Mix kit (Ampliqon, Denmark) and the specific primers (Table 1 ) performed real-time PCR. The 2-∆∆Ct method was utilized to evaluate the outcomes, with the GAPDH gene as the reference gene.
7
Quantifying COX-2 and iNOS Expression in LPS-Stimulated Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR technique was used to assess COX-2 and iNOS genes expression in LPS-stimulated cells in response to MIA and co-treatment with curcumin. The RNeasy mini kit (Qiagen, Hilden, Germany) was used to extract RNA, and the first-strand cDNA synthesis kit (Bio FACT, Daejeon, South Korea) reverse transcribed the RNA into cDNA. The SYBR Green Master Mix kit (Ampliqon, Odense, Denmark) and the specific primers (Table 1 ) were used to perform real-time PCR. The GAPDH gene served as a reference gene, and the outcomes were analyzed using the 2-ΔΔCt method using the formula ΔΔCT = ΔCT(target sample)−ΔCT(control sample).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!