In the HO‐1‐siRNA experiment, the mProx24 cells were grown to 60–80% confluence in the culture medium and then were transfected with HO‐1‐siRNA 13 or control‐siRNA using an siRNA transfection reagent (Life Technologies, Grand Island, NY, USA). Later, the transfection solution was removed, and the cells were washed with PBS two times after transfection for 24 h.
Sirna transfection reagent
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The SiRNA transfection reagent is a laboratory product designed to facilitate the delivery of small interfering RNA (siRNA) into cells. Its core function is to effectively introduce siRNA into the target cells, enabling researchers to study gene expression and function through RNA interference (RNAi) techniques.
Automatically generated - may contain errors
Lab products found in correlation
Reverse transcription reagent, by Thermo Fisher Scientific (3 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Recombinant human tgf β1, by R&D Systems (2 mentions)
Opti mem serum free media, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Sirnas, by GenePharma (1 mentions)
Sirna1, by Genechem (1 mentions)
Non targeting control sirna, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000 regent, by Thermo Fisher Scientific (1 mentions)
On targetplus control pool, by Horizon Discovery (1 mentions)
Sigenome smartpool, by Horizon Discovery (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Cayman Chemical (1 mentions)
Stealth rnai sirna, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Opti mem media, by Thermo Fisher Scientific (1 mentions)
Dnmt3b, by Santa Cruz Biotechnology (1 mentions)
5 n ethyl n isopropyl amiloride eipa, by Merck Group (1 mentions)
21 protocols using sirna transfection reagent
1
Silencing HO-1 Gene in mProx24 Cells
2
Targeted Silencing of Key Cellular Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single siRNA oligonucleotides targeting human ANLN, Cdh1, and USP10 (GenePharma, Supplementary Table 5 ) and negative control siRNA were diluted in siRNA transfection medium (31985-070, Life Technologies) and mixed with siRNA Transfection Reagent (13778150, Life Technologies), according to the manufacturer’s instructions [48 (link)]. Cells were incubated with the transfection complexes for 8 h, followed by incubation in normal growth medium for 40 h.
3
Silencing VDR and ERp57 in Cell Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Opti‐MEM™ Reduced Serum Medium powder (22600134) was from Thermo Fisher Scientific; siRNA transfection reagent, nondirected siRNA sequence (noncomplementary control RNA [siCTRL RNA]), siRNA targeted to VDR (siVDR), and siRNA targeted to ERp57 (siERp57) were all from Santa Cruz Biotechnologies (Dallas, TX, USA). Cell culture media was replaced with 100 μL Opti‐MEM™ serum‐free media (Thermo Fisher Scientific) and incubated at 37°C for 5 to 10 minutes. For VDR, ERp57 knockdown, cells were transfected with 50mM siVDR, siERp57, or siCTRL RNA diluted in siRNA transfection medium/Opti‐MEM™ serum‐free media (Santa Cruz Biotechnologies) in the presence of the recommended concentration of lipid‐based siRNA transfection reagent (Santa Cruz Biotechnologies) according to the manufacturer's instructions, and as described.(64 , 75 )
4
Grx1 Overexpression and Knockdown in Human Lens Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A human lens epithelial cell line (SRA 01/04), which was authenticated using short tandem repeat (STR, Appendix 1) analysis, was cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco-BRL, Grand Island, NY) with 10% certified fetal bovine serum (FBS), 100 U/ml penicillin, and 100 mg/ml streptomycin, and seeded in 6-well culture dishes at a density of 2–3×104 cells per well for 12 h, before transfection, in a humidified atmosphere of 5% CO2 at 37 °C. DNA fragments encoding human Grx1 were chemically synthesized by Genomeditech Company and inserted into pcDNA3.1 to construct sense plasmids (pcDNA3.1-Grx). Lipofectamine 2000 reagent (Invitrogen) was used to transfect 2 μg of pcDNA3.1-Grx per dish according to the manufacturer’s instructions. Empty vector pcDNA3.1 was used as a negative control. The extent of overexpression was evaluated by western blot analysis.
DNA fragments encoding the Grx1 small interfering RNA (siRNA-Grx, 5′-GCCGCTTGCACGTATAGATAC-3′) were purchased from Genomeditech Company. The siRNA transfection reagent (13,778,150; Thermo Fisher Scientific) was used to transfect 100 nmol/L of siRNA-Grx per dish according to the manufacturer’s instructions. A scramble (Scr) sequence was used as a negative control. The extent of knockdown was evaluated by western blot analysis.
DNA fragments encoding the Grx1 small interfering RNA (siRNA-Grx, 5′-GCCGCTTGCACGTATAGATAC-3′) were purchased from Genomeditech Company. The siRNA transfection reagent (13,778,150; Thermo Fisher Scientific) was used to transfect 100 nmol/L of siRNA-Grx per dish according to the manufacturer’s instructions. A scramble (Scr) sequence was used as a negative control. The extent of knockdown was evaluated by western blot analysis.
5
Nrf2 Knockdown in C6 Astroglia Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C6 astroglia cell lines were seeds on 24‐well plates for 24 hours and then transfected with Nrf2‐siRNA (50 nmol/L) or control‐siRNA (50 nmol/L) for 6 hours using siRNA transfection reagent (Thermo Fisher Scientific) using the manufacturer's protocol. The knockdown efficiency was evaluated by Western blotting and real‐time RT‐PCR. After 6 hours of transfection, the transfection solution was removed and cells were treated with EA for 24 hours followed by ROT administration for 24 hours. Afterwards, C6 cells were collected to detect the corresponding indicators.
6
Knockdown and Overexpression of E2F8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To knockdown E2F8, siRNAs targeting the coding region of E2F8 were obtained from GenePharma (Shanghai, PR China), and siRNA transfection reagent (Thermo Fisher Scientific, Waltham, MA, USA) was utilized according to the manufacturer’s protocols. An E2F8 inhibitor lentivirus (shE2F8) was designed based on the sequence of siRNA for E2F8. Nontargeting control siRNA was used as a negative control. The sequences used were as follows: siRNA for E2F8: 5′-GGCCAAAGACUGUAUACACTT-3′ (sense), 5′-GUGUAUACAGUCUUUGGCCTT-3′ (anti-sense); and nontargeting control siRNA (NC): 5′-UUCUCCGAACGUGUCACGUTT-3′ (sense), 5′-ACGUGAC ACGUUCGGAGAATT-3′ (antisense). To overexpress E2F8, ESCC cell lines were transfected with the E2F8-overexpressing recombinant vector pcDNA3.1-E2F8 (GenePharma); the empty plasmid was utilized as the negative control. The primer to overexpress E2F8 was designed as follows: 5′-CGGGATCCGAGGAATTTACAGAATGGAGAAC-3′ (forward); 5′-CCCGCTCTAGATTAATGGACATCCTCTGTTGAGACTTC-3′ (reverse).
7
Stable knockdown and siRNA silencing
8
Importin β1 and α5 Knockdown Impacts NDV Replication
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequences of three pairs of siRNA designed to knockdown importin β1 or importin α5 in DF-1 cells were shown in supplemental Table S1. Negative siRNA control (Cat. No.12935-400) and siRNA transfection reagent were purchased from Invitrogen. For transfection with the siRNA against importin β1 or importin α5, low-passage DF-1 cells were transfected with the indicated siRNAs at a confluence of 80% on 35 mm dishes, and the knockdown efficiency was checked by immunoblot analysis at 48 h post-transfection. To study the effect of importin β1 or importin α5 knockdown on the subcellular localization of M protein and the replication of NDV, the NDV strain rSS1GFP was used to infect importin β1 or importin α5 siRNA-treated DF-1 cells at an MOI of 1. The subcellular localization of M protein was examined by immunofluorescence assay and immunoblotting analysis and at 6 hpi and 12 hpi, respectively. In addition, the cell culture supernatants and cell pellets were collected at the indicated time points (6, 12, 24, 48, and 72 hpi), and the virus titers were determined as 50% tissue culture infective dose (TCID50) in DF-1 cells [78 (link)]. Moreover, the CPE and green fluorescence in virus-infected cells were observed under fluorescence microscope and the GFP expression level was detected by Western blotting at 24 hpi.
9
Stat3 Knockdown Using siRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stat3 siRNAs were used to reduce Stat3 expression. Briefly, a transfection mixture containing three specific Stat3 siRNAs (siRNA1, siRNA2, and siRNA3) and siRNA transfection reagent (Invitrogen, USA) was incubated for 20 min at room temperature, and the cells were then incubated with this mixture for 6 h at 37°C. The control containing nontargeting scramble siRNA was incubated in parallel. The following siRNA sequences (5′ to 3′) were synthesized by GeneChem (Shanghai, China):
siRNA1, GAAGCCAATGGAAATTGCCCGGATT
siRNA2, GGAGGAGAGGATCGTGGATCTGTT
siRNA3, GGAGGAGGCATTCGGAAAGTATT for Stat3
siRNA1, GAAGCCAATGGAAATTGCCCGGATT
siRNA2, GGAGGAGAGGATCGTGGATCTGTT
siRNA3, GGAGGAGGCATTCGGAAAGTATT for Stat3
10
Silencing H19 Modulates Chemosensitivity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA specific for H19 was purchased from Invitrogen (Thermo Fisher Scientific). To minimize nonspecific effects of interfering RNAs, non-targeting control siRNA, also obtained from Invitrogen, was used as negative control (NC). The siRNA transfection reagent (Invitrogen) was used according to the manufacturer’s protocol. Briefly, 3 × 104 cells in media without antibiotic were plated in 6-well plates and then transfected with 100 nM siRNA for H19 or NC when cells were 70% confluence the plate well at 24 hours using lipofectamine 2000 regent (Thermo Fisher Scientific). The cells were sampled at indicated time point for the different experiments with indicated purposes such as cell proliferation, invasion, and protein expression. For the validation of chemosensitivity experiment, cells with 24 hours siRNA transfection and then treated with tamoxifen in multiple concentrations and analyzed the cell proliferation and apoptosis rate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!