The largest database of trusted experimental protocols

Anti histone h3k27me3

Manufactured by Cell Signaling Technology
Sourced in United States

Anti-Histone H3K27me3 is a lab equipment product that detects the trimethylation of histone H3 at lysine 27. This modification is associated with transcriptional repression and is involved in the regulation of gene expression.

Automatically generated - may contain errors

5 protocols using anti histone h3k27me3

1

Chromatin Immunoprecipitation of H3K27me3 in A375 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A375 cells plated in 10 cm dishes were treated with DMSO or 10 μM GSK126 for 48 h respectively. Then cells were fixed with 1% formaldehyde for 10 min at room temperature. To stop the reaction, glycine was added to a final concentration of 0.125 M at room temperature for 5 min. Cells were scraped into cold PBS with proteinase inhibitor and transferred with contents of each group to a 15 mL tube. ChIP assay was performed using SimpleChIP Plus Enzymatic Chromatin IP Kit (Magnetic Beads) (Cell Signaling Technology, #9005) and anti-Histone H3K27me3 (Cell Signaling Technology, #9733) according to the procedures provided by the manufacturer. The final ChIP DNA samples were then used as templates in qPCR reactions. Primers were designed according to our previous ChIP-seq results.16 The sequences of the primers were as follows:
PrimersSequences (5’–3’)Position from TSS

ELOVL2 peak20688-FGAGGCCACCGTTCTGTTCA-701 ∼ -576
ELOVL2 peak20688-RGCGGATCAGTTCGGATAACG

ELOVL2 peak8265-F1AGCGGCTGGGTTTCTATCAG679 ∼ 763
ELOVL2 peak8265-R1GGGAAATCGGGCAGAGAGAG

ELOVL2 peak8265-F2GTCAAGCTCTTGCCCCTCTC580 ∼ 712
ELOVL2 peak8265-R2TCCGAGCCCAGACACTGATA

SCD1 peak3138-F1AGTGGCCAGTGACAAACACA-19422 ∼ -19311
SCD1 peak3138-R1TGCAAGCCCTCTAGGAAAGC

SCD1 peak3138-F2AGCTTTCCTAGAGGGCTTGC-19331 ∼ -19182
SCD1 peak3138-R2TAGGTGTTCTAGGCTCCGCA

SCD1 peak1160-FCCTTCCTTGCCCATCACCTT-17807 ∼ -17691
SCD1 peak1160-RCTCTACAAGCCAGGGCCTTC
+ Open protocol
+ Expand
2

Histone H3K27M and H3K27me3 IHC

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissue immunohistochemistry was performed as follows: serial sections of four microns were cut from paraffin blocks. Antigen retrieval was performed using 1× DAKO Target Retrieval Solution pH 6 (Dako S1699). Slides were incubated in Biocare Medical Decloaking Chamber at 110 °C for five minutes, followed by incubation in PBS for five minutes. Primary antibodies were prepared to a final volume of 200 μL using antibody diluent (Dako S0809) as follows: rabbit polyclonal anti-Histone H3K27M (Millipore ABE419) 1:1000 and rabbit monoclonal anti-Histone H3K27me3 (Cell Signaling Technology #9733) 1:100. Slides were incubated with primary antibody at 4 °C overnight then washed for three minutes in TBST (Dako S3306). Immunohistochemical reactions were visualized using DAB chromogen (Dako K4011). The slides were counter stained with hematoxylin for one minute at room temperature, washed with tap water and dehydrated with graded alcohol and xylene, and finally coverslip using a xylene-based mounting medium. Hematoxylin and Eosin (H&E) staining was performed on each specimen to validate tumor diagnosis by the Pathology Department at the Ann & Robert H. Lurie Children’s Hospital of Chicago.
+ Open protocol
+ Expand
3

Comprehensive Antibody Validation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Anti-beta-Actin (clone AC15, Abcam, Cambridge, UK; used in 1:5000 for Western Blotting (WB)), anti-SSX2/SSX3 (clone 1A4, Novus Biologicals, CO, USA; used 1:700 for IHC (immunohistochemistry), 1:100 for fluorescence microscopy and 1:100 for ICC (immunocytochemistry)), anti-SSX2-4 (clone E3 (39 (link)); used 1:3000 for WB), anti-BMI1 (Cell Signaling, MA, USA; used 1:200 for ICC, 1:100 for fluorescence IHC and 1:1000 for WB), anti-EZH2 (Cell Signaling; used 1:200 for ICC and 1:1000 for WB), anti-histone H3K27me3 (Cell Signaling; used 1:200 for ICC and 1:1000 for WB) and anti-H3 (clone FL136, Santa Cruz Biotech; used 1/1000 for WB).
+ Open protocol
+ Expand
4

Histone H3K27me3 ChIP-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
MC38 cells plated in 10 cm dishes were treated with the methods shown in Figure 3A. Then cells were fixed with 1% formaldehyde for 10 min at room temperature. To stop the reaction, glycine was added to a final concentration of 0.125 M at room temperature for 5 min. Cells were scraped into cold PBS with proteinase inhibitor and transferred with contents of each group to a 15 mL tube. A ChIP assay was performed using a Simple ChIP Plus Enzymatic Chromatin IP Kit (Magnetic Beads) (Cat#: 9005, Cell Signaling Technology) and anti-histone H3K27me3 (Cat#: 9733, Cell Signaling Technology) according to the procedures provided by the manufacturer. The final ChIP DNA samples were then used as templates in qPCR reactions. Primers were designed upon different promoter regions shown in Figure 5E.
+ Open protocol
+ Expand
5

Histone Modification Analysis by Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blot analyses were carried out as previously described (13) . Briefly, cells were lysed with 1% Triton X-100 or NP-40 with 1X protease inhibitor cocktail (MCE, HY-K0010). Lysates were resolved on SDS-PAGE followed by immunoblotting. Anti-Histone H3 (Cell Signaling Technology, cat. #4499), Anti-Histone H3K27me3 (Cell Signaling Technology, cat. #9733), and other primary antibodies were used. When indicated, cell were treated with an EZH2 inhibitor GSK-126 (MCE, HY-13470) or agonist GSK-J4 (MCE, HY-15648B) for 7 to 14 days. For immunoprecipitation experiments, whole-cell lysates were precleared with protein A/G beads (MCE, HY-K0202) and incubated with IgG control or anti-AcK antibody (1:100, Cell Signaling Technology, 9441) for overnight rocking at 4 C. Protein G beads were added and mixed for another 4 hours. For anti-avi immunoprecipitation experiments, lysates from cells coexpressing Escherichia coli biotin holoenzyme synthetase (BirA) and indicated proteins were incubated with streptavidin-conjugated magnetic beads (Promega, Z5482) for 4-hour rocking at 4 C. Immunocomplexes were resolved on SDS-PAGE, followed by immunoblotting.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!