Total RNA was extracted using an Easy-Blue™ Total RNA extraction kit according to the manufacturer's instructions and reverse transcription of RNA to cDNA was performed using an ABI cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA) (conditions: 37°C for 1 h, followed by 95°C for 5 min). TaqMan quantitative RT-PCR with an ABI StepOne Plus detection system was performed according to the manufacturer's instructions (Applied Biosystems; Thermo Fisher Scientific, Inc.). For each sample, triplicate test reactions and a control reaction without reverse transcriptase were analyzed for expression of the gene of interest and to control for variations in the reactions. All qPCR data were normalized to levels against the housekeeping gene hypoxanthine guanine phosphoribosyltransferase (HPRT). Forward, reverse, and probe oligonucleotide primers for multiplex real-time TaqMan PCR were purchased from ABI (Applied Biosystems; Thermo Fisher Scientific, Inc.). Cycling conditions were 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. The data were analyzed using StepOne™ software (version 2.3; Applied Biosystems; Thermo Fisher Scientific, Inc.). The 2−ΔΔCq method was used to determine the relative mRNA expression level (20 (link)).
Abi cdna synthesis kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI cDNA Synthesis Kit is a laboratory tool designed for the reverse transcription of RNA into complementary DNA (cDNA). The kit provides the necessary reagents and enzymes to facilitate this process, enabling the conversion of RNA samples into more stable and versatile cDNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Mirnaeasy mini kit, by Qiagen (6 mentions)
Abi viia7 fast real time pcr system, by Thermo Fisher Scientific (4 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Easy blue total rna extraction kit, by Thermo Fisher Scientific (1 mentions)
Stepone software, by Thermo Fisher Scientific (1 mentions)
Abi stepone plus detection system, by Thermo Fisher Scientific (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Steponeplus detection system, by Thermo Fisher Scientific (1 mentions)
Genequant pro, by Harvard Bioscience (1 mentions)
Viia7 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Truseq stranded mrna sample preparation kit, by Illumina (1 mentions)
Magna rip rna binding protein immunoprecipitation kit, by Merck Group (1 mentions)
Sybr select master mix, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
11 protocols using abi cdna synthesis kit
1
Quantitative RT-PCR Analysis of Gene Expression
2
XBP1 Expression Profiling by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were harvested and RNA was extracted using the RNeasy Kit from Qiagen (Germantown, MD). First-strand cDNA was synthesized from the DNA-free RNA by using random hexamer primers and the ABI cDNA synthesis kit (Applied Biosystems, Grand Island, NY). Forward primer AAACAGAGTAGCAGCTCAGACTGC and reverse primer TCCTTCTGGGTAGACCTCTGGGAG were used to amplify XBP1 cDNA. Amplified products were separated on a 2% agarose gel and visualized under UV light.
3
Quantifying Cytokine Expression in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from different mouse organs as indicated using QIAGEN miRNAeasy Mini Kit (QIAGEN). After confirming the quality of RNA, ABI cDNA Synthesis Kit (Applied Biosystems, Carlsbad, CA) was used to prepare cDNA. Real time PCR was performed using an ABI ViiA7 fast real-time PCR system and TaqMan gene expression assays according to the manufacturer's protocol. All relevant probes (mouse specific Taqman probe for IL-17A, IL-6, TNF-α, GAPDH) were purchased from Applied Biosystems (Carlsbad, CA).
4
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated with Easy-Blue™, and the purity of the samples was confirmed by RNA calculator (Gene Quant Pro, Biochrom). The total RNA extraction kit was used according to the manufacturer's instructions and reverse transcription of RNA (10 µg) to cDNA was performed using the ABI cDNA synthesis kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) (conditions: 37°C for 1 h, followed by 95°C for 5 min). TaqMan quantitative RT-PCR with an ABI StepOne Plus detection system was performed according to the manufacturer's instructions (Applied Biosystems; Thermo Fisher Scientific, Inc.). All qPCR data were normalized to the expression levels of the housekeeping gene hypoxanthine guanine phosphoribosyltransferase (HPRT). The thermocycling conditions used for qPCR were as follows: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. The commercial forward, reverse, and probe oligonucleotide primers for multiplex real-time TaqMan PCR were purchased from ABI (cat. no. 4304437; Applied Biosystems; Thermo Fisher Scientific, Inc.). The 2−ΔΔCq method was used to determine the relative mRNA expression level (21 (link)).
5
RNA Extraction and qRT-PCR Analysis
6
Total RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HCC tumor tissues using the QIAGEN miRNAeasy Mini Kit (QIAGEN, Valencia, CA, USA). The cDNA preparation was performed using an ABI cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA). Real-time polymerase chain reaction (RT-PCR) was performed using an ABI ViiA7 fast real-time PCR system and Taqman gene expression assays according to the manufacturer’s protocol (Applied Biosystems, Foster City, CA, USA).
7
RNA-Seq Analysis of AEG-1 Hepatocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from AEG-1-WT
and AEG-1-C75S hepatocytes
using the QIAGEN miRNAeasy Mini Kit (QIAGEN, Valencia, CA). cDNA preparation
was done using the ABI cDNA synthesis kit (Applied Biosystems, Foster
City, CA). The RNA-Seq library was prepared using the Illumina TruSeq
stranded mRNA sample preparation kit and sequenced on the Illumina
HiSeq3000 platform. RNA-Seq libraries yielded about 25–40 M
reads per sample. All sequencing reads were quality controlled using
FastQC v0.11.2. Illumina adapters were trimmed using TrimGalore! V.0.6.6;
replicates were aligned to the reference genome (UCSC mouse genome
build mm10) using STAR v.2.7.9a. Mus_musculus.GRCm38.100.gtf gene
definition file was used. Differential expression analysis was performed
using edgeR v3.36.0. Genes having counts per million less than 2 in
all samples were excluded. Differentially expressed genes were defined
using false discovery rate (FDR) cut-off value of 0.05. All bioinformatics
analyses were conducted in R/Bioconductor computing environment v4.0.1.
The data is available on GEO under the GSE215113 accession number
(reviewer access token qbilqyiqdzsjvun).
and AEG-1-C75S hepatocytes
using the QIAGEN miRNAeasy Mini Kit (QIAGEN, Valencia, CA). cDNA preparation
was done using the ABI cDNA synthesis kit (Applied Biosystems, Foster
City, CA). The RNA-Seq library was prepared using the Illumina TruSeq
stranded mRNA sample preparation kit and sequenced on the Illumina
HiSeq3000 platform. RNA-Seq libraries yielded about 25–40 M
reads per sample. All sequencing reads were quality controlled using
FastQC v0.11.2. Illumina adapters were trimmed using TrimGalore! V.0.6.6;
replicates were aligned to the reference genome (UCSC mouse genome
build mm10) using STAR v.2.7.9a. Mus_musculus.GRCm38.100.gtf gene
definition file was used. Differential expression analysis was performed
using edgeR v3.36.0. Genes having counts per million less than 2 in
all samples were excluded. Differentially expressed genes were defined
using false discovery rate (FDR) cut-off value of 0.05. All bioinformatics
analyses were conducted in R/Bioconductor computing environment v4.0.1.
The data is available on GEO under the GSE215113 accession number
(reviewer access token qbilqyiqdzsjvun).
8
Quantitative RNA Expression Analysis
9
RNA Immunoprecipitation in Liver Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA immunoprecipitation using lysates from AEG‐1‐WT and AEG‐1‐L24K/L25H livers and control immunoglobulin G (IgG) and anti‐AEG‐1 antibody (rabbit polyclonal; in‐house) was performed using Magna RIP RNA Binding Protein Immunoprecipitation kit (Millipore, Burlington, MA) according to the manufacturer’s protocol, and RNA was extracted from the immunoprecipitates using the QIAGEN miRNAeasy Mini Kit (QIAGEN, Valencia, CA). Total RNA from livers and hepatocytes was extracted using the same kit. Complementary DNA preparation was done using ABI cDNA synthesis kit (Applied Biosystems, Foster City, CA). Quantitative real‐time PCR was performed using an ABI ViiA7 fast real‐time PCR system and Taqman gene‐expression assays according to the manufacturer’s protocol (Applied Biosystems).
10
Quantifying Viral and Cellular RNA Dynamics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 cells were infected with A/WSN/33 or A/California/7/2009 virus at an MOI 3 or 10 PFU/cell, respectively. At 0, 2, 4 and 6 hpi RNA was extracted from cells using TRIzol (Invitrogen; 15596026). RNA was isolated and precipitated following the manufacturer’s instructions and 200ng was reverse transcribed into cDNA using the ABI cDNA synthesis kit (Applied Biosystems; 4368814). For all cellular targets RT was performed using an oligo dT, while viral RNA underwent separate RT reactions with primers specific to each mRNA or vRNA [44 (link)]. These primers are listed in S4 Table alongside the primers used for qPCR amplification. All qPCR experiments were performed using SYBR Select Master Mix (Applied Biosystems; 4472908) following the manufacturer’s instructions. All qPCR data were quantified using the DDCT method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!