Yeast strains expressing different mNeonGreen-tagged WSC1 gene variants were analyzed by microscopy after growth to logarithmic phase under a Zeiss Axiovert 200M microscope using (i) transmission light microscopy (TM) and (ii) fluorescence microscopy with a GFP filter set (AHF Analysentechnik AG, Tübingen, Germany). Cells were photographed with a Hamamatsu Orca ER digital camera, and pictures were processed and analyzed using the Improvision Volocity software (Improvision, Coventry, UK).
Orca er digital camera
Manufactured by PerkinElmer
Sourced in Japan
The ORCA-ER digital camera is a high-performance imaging device designed for use in scientific and research applications. It features a large sensor with a high resolution and low noise characteristics, enabling the capture of high-quality images and data. The camera's core function is to provide accurate and reliable image acquisition for a variety of scientific experiments and analyses.
Automatically generated - may contain errors
Lab products found in correlation
Volocity software, by PerkinElmer (2 mentions)
Dm irb microscope, by Leica (2 mentions)
Lsm 510 meta laser scanning microscope system, by Zeiss (2 mentions)
Axiovert 200m microscope, by Zeiss (1 mentions)
Axio imager m1 microscope, by Zeiss (1 mentions)
Matrigel, by BD (1 mentions)
Microtome, by Thermo Fisher Scientific (1 mentions)
Eclipse 90i, by Nikon (1 mentions)
6 protocols using orca er digital camera
1
Analyzing mNeonGreen-tagged Wsc1 Localization
2
Teratoma Formation Assay in SCID Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
iPSCs were resuspended in 50 μl of medium, mixed with 50 μl of Matrigel (BD Biosciences), and injected into the hindlimb femoral muscle of immunodeficient SCID (severe combined immunodeficient) mice according to the approved institutional animal protocol. After 10 weeks, teratomas were harvested and fixed in the Bouin’s solution overnight. The fixed teratomas were embedded in paraffin wax and serially sectioned using the microtome (Thermo Fisher Scientific). The sections were stained with hematoxylin and eosin using a standard protocol. Images were acquired using the Axio Imager M1 microscope (Zeiss) equipped with the Hamamatsu ORCA-ER digital camera and analyzed by the Volocity software (Improvision).
3
Multimodal Microscopic Imaging Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Confocal images were acquired using an LSM 510 META Laser Scanning Microscope system (Zeiss, Thornmood, NY, USA). By varying the width of the pinhole of the detectors, the observed fluorescence was localized to a known thickness of observed tissue and the depth of field of the transmitted and DIC images was adjusted. Scale bars were integrated into the image during acquisition. Epifluorescence images were acquired on a Leica DM IRB inverted microscope system (Wetzlar, Germany) using a Hamamatsu ORCA-ER digital camera (Hamamatsu City, Japan) controlled with Improvision Openlab software version 5.0.2 (Lexington, MA, USA). Scale bars were calibrated to each objective magnification and added after acquisition. Light microscopic images were acquired with a Nikon D100 (Tokyo, Japan) digital SLR camera on an inverted Leica DM IRB microscope.
4
Visualization of ribosomal subunit biogenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were visualized using a Zeiss Axioplan 2 microscope equiped with a 63× objective, a Hammamutsu ORCA-ER digital camera and Openlab (Improvision) cell imaging analysis software. The Rpl25-EGFP and Rps2-GFP reporter assays to monitor pre-40 and pre-60S nuclear accumulation were performed as previously described [54] (link).
5
Fluorescent Markers for Vesicle and Neuron Imaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For imaging dense core vesicle (Pceh-10-IDA-1::cherry) and neuropeptide fluorescent markers (Pceh-10-INS-22::GFP), expression patterns of UNC-39 (Punc-39-GFP, Punc-39-UNC-39::GFP) and RID phenotypes in unc-39 mutants using RID fluorescent markers (Pceh-10::GFP) and RID cell fate markers (Pkal-1-GFP, Pser-2-GFP, Pmod-1-GFP), images were captured using a 63x objective on a Zeiss Axioplan two connected to a Hamamatsu ORCA-ER digital camera and processed using Improvision Open Lab software. Images were processed using minimal deconvolution levels to remove background fluorescence. Confocal images of transgenic strains carrying either Pflp-14-GFP, Pins17-GFP, unc-3fosmid::SL2::GFP, and unc-39fosmid::GFP were acquired on a Nikon Eclipse 90i confocal microscope. Confocal image processing was conducted using Adobe Photoshop. The primer pair to generate a 4.3 kb Pflp-14 fragment are tactgtcgaccgacaaacacccaaatatcc (forward, SalI) and aactggatcctccttcggattgtgtggag (reverse, BamHI).
6
Imaging Techniques for Microscopic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Confocal images were acquired using a Zeiss LSM 510 META Laser Scanning Microscope system (Thornmood, NY). By varying the width of the pinhole of the detectors, the observed fluorescence was localized to a known thickness of observed tissue and the depth of field of the transmitted and differential interference contrast images was adjusted. Scale bars were integrated into the image during acquisition. Epifluorescence images were acquired on a Leica DM IRB inverted microscope system (Wetzlar, Germany) using a Hamamatsu ORCA-ER digital camera (Hamamatsu City, Japan) controlled with Improvision Openlab software version 5.0.2 (Lexington, MA). Scale bars were calibrated to each objective magnification and added after acquisition. Light microscopic images were acquired with a Nikon D100 (Tokyo, Japan) digital SLR camera on an inverted Leica DM IRB microscope.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!