Apply TRIzol reagent (Sigma-Aldrich) to gain total RNAs from HNSC tissues, then reversely transcribed to cDNA with the reverse transcription kit (TaKaRa). qRT-PCR was conducted by SYBR qPCR Master Mix (Thermo Fisher). The 2−ΔΔCt method was utilized to quantify the relative mRNA expression, and ß-actin was selected as the inner control. The sequences of CCDC60 were as follows: CCTCTTCCGCCAGCTCTGTG (sense) and CACCCGGGTCCTTTGGGTTC (antisense). The sequences of ß-actin were as follows: CACCATTGGCAATGAGCGGTTC (sense) and AGGTCTTTGCGGATGTCCACGT (antisense).
Sybr qpcr master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States, Finland
SYBR qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains all the necessary components, including SYBR Green I dye, for the amplification and detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Rg 3000a, by Qiagen (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Merck Group (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Dnase treatment, by Thermo Fisher Scientific (1 mentions)
Micro rna isolation kit, by Zymo Research (1 mentions)
Viia7, by Thermo Fisher Scientific (1 mentions)
7500 qpcr system, by Thermo Fisher Scientific (1 mentions)
Lna primers, by Qiagen (1 mentions)
Mircury lna universal rt, by Qiagen (1 mentions)
Taqman reagent, by Thermo Fisher Scientific (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
23 protocols using sybr qpcr master mix
1
Quantifying CCDC60 mRNA Levels in HNSC
2
Conjunctival Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The conjunctiva was lysed by RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) following the manufacturer's protocols. The cDNA was synthesized from the total RNA by SuperScript III (Thermo Fisher Scientific) and subjected to qRT-PCR for quantification of PI3K, Eotaxin, and RANTES by using SYBR qPCR Master Mix (Thermo Fisher Scientific). The relative expression of genes was normalized to GAPDH level and calculated by comparative threshold cycle method.
3
Selenium Modulates Aquaporin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HFF-1 cells were cultured at a density of 2 × 104 cells/well in a 12-well plate for 48 h, then the cells were treated with Se-MBFBs (1.56, 3.13, 6.25%). After 48 h of incubation, the cells were harvested and washed once with PBS, then total mRNA in HFF-1 cells was extracted by RNA Extraction kit according to the manufacturer's instructions, then total mRNA was reverse transcribed into cDNA according to the Reverse transcription kit instructions. The mRNA expression level was detected by SYBR qPCR Master Mix (Thermofisher, Beijing, China) according to the light quantitative PCR kit instructions. The specific primers used were as follows: AQP3, 5′-CCTTTGGCTTTGCTGTCACTC-3′(F), 5′-ACGGGGTTGTTGTAAGGGTCA-3′(R); GAPDH, 5′-AAGAAGGTGGTGAAGCAGG-3′(F), 5′-AGGTGGAGGAGTGGGTGTCG-3′(R). The gene GAPDH was employed as an internal reference and the relative mRNA level of target genes was calculated by using the 2−ΔΔCt method.
4
Quantitative Analysis of SNHG1 and miR-329-3p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Total RNA was reverse transcribed into cDNA using a SuperScript® VILO™ cDNA Synthesis kit (Invitrogen; Thermo Fisher Scientific, Inc.). qPCR was subsequently performed on a Prism 7000 Real-Time PCR Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using SYBR qPCR Master mix (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The primers used for the qPCR were purchased from Genscript and the primer sequences are listed as follows:
GAPDH, forward 5'-CTTTGGTATCGTGGAAGGACTC-3' and reverse, 5'-GTAGAGGCAGGGATGATGTTCT-3'; U6, forward, 5'-GCTTCGGCAGCACATATACTAAAAT-3' and reverse, 5'-CGCTTCACGAATTTGCGTGTCAT-3'; lncRNA SNHG1, forward, 5'-CCAAACTCAGGCACTGTATAGAT-3' and reverse, 5'-ACAGACACGAAGTGGAGTTATG-3'; and miR-329-3p, forward, 5'-GTGGAACAGACCTGGTAAAC-3' and reverse, 5'-CAAGTGCGAGTCGTGCAGT-3'. The following thermocycling conditions were used for the qPCR: Initial denaturation for 5 min at 95˚C, followed by 40 cycles of 95˚C for 10 sec and 60˚C for 30 sec. The relative mRNA expression levels of SNHG1 and microRNA (miRNA/miR)-329-3p were calculated using the 2-ΔΔCq method (27 (link)), and GAPDH or U6 were used as the internal controls for normalization of SNHG1 and miR-329-3p expression, respectively.
GAPDH, forward 5'-CTTTGGTATCGTGGAAGGACTC-3' and reverse, 5'-GTAGAGGCAGGGATGATGTTCT-3'; U6, forward, 5'-GCTTCGGCAGCACATATACTAAAAT-3' and reverse, 5'-CGCTTCACGAATTTGCGTGTCAT-3'; lncRNA SNHG1, forward, 5'-CCAAACTCAGGCACTGTATAGAT-3' and reverse, 5'-ACAGACACGAAGTGGAGTTATG-3'; and miR-329-3p, forward, 5'-GTGGAACAGACCTGGTAAAC-3' and reverse, 5'-CAAGTGCGAGTCGTGCAGT-3'. The following thermocycling conditions were used for the qPCR: Initial denaturation for 5 min at 95˚C, followed by 40 cycles of 95˚C for 10 sec and 60˚C for 30 sec. The relative mRNA expression levels of SNHG1 and microRNA (miRNA/miR)-329-3p were calculated using the 2-ΔΔCq method (27 (link)), and GAPDH or U6 were used as the internal controls for normalization of SNHG1 and miR-329-3p expression, respectively.
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TOOLSmart RNA Extractor reagent (Tools, Taiwan) and reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). Each 20 μL reaction contained 2 × SYBR qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 1 μM forward and reverse primers 1 μL (Table 1 ), and 2 μL cDNA. The PCR was performed on the Applied Biosystems 7500 Real-Time PCR System, and the cycling conditions were 95 °C for 1 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 60. Target gene expression was quantified by the 2−ΔΔCT method with GAPDH used as the internal control. The PCR reaction was repeated triplicate for each sample.
6
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA content was isolated from cells using TRIzol® reagent (Life Technologies, USA) according to the manufacturer’s protocol. Then, the total RNA was reverse transcribed to cDNA using the PrimeScript RT Reagent Kit (TaKaRa, China). All reactions were conducted using the Prism 7000 Real-Time PCR system and SYBR qPCR Master Mix (Thermo Fisher Scientific, Inc., USA) according to the manufacturer’s protocol. Primer sequences were obtained from SANGON Biotech Co., Ltd., China. The following thermal cycling conditions were applied for qRT-PCR: initial denaturation for 5 min at 95°C, followed by 40 cycles of 10 s at 95°C and one cycle of 30 s at 60°C. GAPDH for mRNA and U6 for miRNA were used as the internal controls. The relative expression levels of WT1-AS, miR-186-5p, and CADM2 were analyzed using the 2−ΔΔCq method [44 (link)]. Primer sequences were synthesized by Sangon Biotech (Shanghai, China) and are listed in Table 1 .
7
Isolation and Analysis of Fetal Thymic RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from fetal thymic lobes, the pharyngeal region, or sorted cells. RNA was prepared and purified using the miRNana kit (Ambion, Thermo Fisher Scientific), and for small numbers of cells, the MicroRNA Isolation kit (Zymo Research) was used. Contaminating DNA was removed by DNase treatment (Applied Biosystems, Thermo Fisher Scientific) or in-column DNase digestion (Zymo Research). RNA was reverse transcribed (Applied Biosystems, Thermo Fisher Scientific) to cDNA. qRT-PCR was performed with SYBR qPCR Master Mix (Thermo Fisher Scientific) to check the expression of Plods and ECM genes, which were normalized to Gapdh. scRNA-Seq and data analysis are described in the Supplemental Methods .
8
ESCC Tissue and Cell RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ESCC tissues and cells using TRIzol reagent (Invitrogen). Then, 1 μg of the total RNA was reverse transcribed into cDNA as detailed by the manufacture (Roche). Quantitative real‐time PCR assay was performed using the SYBR qPCR Master Mix (Life Technology). Relative expression levels of lncRNA/mRNA were normalized to that of the housekeeping gene β‐actin and quantitated by the comparative cycle threshold (Ct) method (2−ΔΔCt). Primers sequences and reaction assays for this study are displayed in Table S2 .
9
Quantitative Analysis of TET Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by the TRIzol reagent (Invitrogen), and 1 μg total RNA was used for reverse transcription according to the manufacturer's protocol (Life Technologies). The relative gene expression levels were measured by SYBR qPCR master mix (Life Technologies) with Applied Biosystems Viia 7. The following PCR primers were used: Tet1-F 5′-AGGGCCAAAATGAAGCAGAA-3′ and Tet1-R 5′-GAGGCTGATGAAAAGCTCTTAGTGT-3′, Tet2-F 5′-GGCAAATGTGAAGGATGCAA-3′ and Tet2-R 5′-CCAGCTCCTAGATGGGTATAATAAGG-3′, and Tet3-F 5′-CGCCTCACGGGAGACAAT-3′ and Tet3-R 5′-AGTGGCCAGATCCTGAAAGCT-3′. 18S was used for internal control: forward 5′-CGGCTACCACATCCAAGGAA-3′ and reverse 5′-CCTGTATTGTTATTTTTCGTCACTACCT-3′. The PCR program starts with the denaturation step of 10 min at 95°C, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C. The relative expression levels were then calculated using the 2−∆∆CT method.
10
Isolation and Gene Expression Analysis of Synovial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ESM and BMSM were isolated by flow cytometry from the synovium, and then total RNA was extracted from SM with Trizol reagent (Life technology). RNA as reverse-transcribed to cDNA with the PrimeScriptTM RT reagent kit (Takara), and gene expression was assayed by quantitative RT-PCR with SYBR qPCR master mix (Life technology) and the 7,500 qPCR system (Applied Biosystems). cDNA samples were assayed in triplicate and expression was normalized by using endogenous control GAPDH. All primer for qRT-PCR were listed in the Supplementary Information .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!