Cfx 96 touch biorad qpcr thermocycler

U6-sgRNA-E + F scaffold and EFS-NS-Cas9-P2A-ZeocinR-WPRE digested from pTF vector with AflII and HindIII and cloned into the piggyBac backbone (De Santis et al., 2018 (link)). sgRNAs targeting Klf5 (5′ TGGCGAATTAACTGGCAGAG), Nanog (5′ TGTCCTTGAGTGCACACAGC), Oct4 (5′ CCGCCCGCATACGAGTTCTG), Zbtb10 (5′ AGAAACGGCTGCCTGCAACC), Zbtb11 (5′ AGCGCACAAGTCTGTCCTCT), Zfp131 (5′ GTTCTTTAAAGTGTCCAAAG) and non-targeting sgRNA (5′ GCCGCAACGTTAGATGTATA) were cloned into piggyBac plasmids. Equimolar ratio (0.5 μg) of plasmids were pooled and co-nucleofected (Lonza) with 0.5 μg pBac transposase to mESCs (De Santis et al., 2018 (link)). DNA was collected with >10,000 cells per sgRNA coverage d1, d3, d6, d9, and d13 post-transduction. PCR1 reaction described above was used to amplify the sgRNA construct from the genome. qPCR primers were designed to overlap sgRNA and scaffold (5′ CGGTGCCACTTTTTCAAGTTG). 10 μL Maxima SYBR Green brilliant PCR amplification kit (Thermo Scientific), 5 uL forward and reverse primer mix (2 nM), 5 μL of PCR1 reaction (2 ng) were combined for the qPCR reaction using CFX 96 Touch Biorad qPCR thermocycler (Biorad). Δct was calculated by subtracting the mean Cq of each sgRNA to a non-targeting control. ΔΔct was calculated by subtracting the Δct of each time point from the d1 original abundance. The average depletion rate was drawn with error bars (n = 3).