Si control

Small interfering RNA targeting SNHG3 (si-SNHG3 #1, 5ʹ-GGGAGAGUAGGUAAACUGA-3ʹ; si-SNHG3 #2, 5ʹ-UGGUACUGUU GAAGGAAAC-3ʹ; SNHG3 #3, 5ʹ-GCUAAGAGGAGUGAGGCAG-3ʹ), si-control (5ʹ-TTCTCCGAACGTGTCACGT-3ʹ), miR-216a (5ʹ-UAAUCUCAGCUGGCAAC UGUGA-3ʹ), miR-control (5ʹ-CCGACUGCAGUCGC-3ʹ), and anti-miR-216a (5ʹ-GCAGCGCCTGTGAGAGGGAT GAAAA-3ʹ) were acquired from GenePharma (China). The sequences of SNHG3 (NR_036473.1) were amplified with primers (Forward 5ʹ-TGACGGAGTCGGTTTGTCACTC-3ʹ; Reverse 5ʹ-ACGAATGGGGCTGA CTCATCTG-3ʹ) and incorporated into the pcDNA-3.1 vector (Invitrogen, USA) to create pcDNA-SNHG3 (SNHG3). Cells were transfected using Lipofectamine 2000 (Invitrogen, USA).

The full-length coding region of FOXF2 cDNA was amplified by PCR from normal human cells, inserted into the mammalian expression vector pcDNA3.1, and then confirmed by sequencing. A small interfering RNA (siRNA) targeting human PRUNE2 (siPRUNE2; GGGCCAGAATATCGATGAATT) and a nontargeting siRNA control (siControl; UUCUCCGAACGUGUCACGUTT) were synthesized by GenePharma Company. Transient transfection of the plasmids or siRNAs into cells was performed using Lipofectamine 2000 (11668-019; Invitrogen) according to the manufacturer's protocol. For cell transfection, 1 × 10⁵ cells were plated in a 6-well plate at 37 °C overnight. Then, 100 pmol of siPRUNE2 or NC siRNA or 2 μg of pcDNA3.1-FOXF2 or empty pcDNA3.1 vector and 15 μL of Lipofectamine were incubated at room temperature for 20 min. The mixtures were transfected into cells for 48 h. The efficiency of transfection was determined by Western blot.

A recombinant lentiviral vector overexpressing IRE1α was used to further explore how miR-124-3p modulates ER stress by targeting IRE1α. siRNA lentiviral particles targeting IRE1α (si-IRE1α) or a scrambled siRNA control (si-control) (Gene Pharma, Shanghai, China) were transfected into HT22 neurons to knock down IRE1α mRNA expression (Gene Pharma). Two days after transfection, PCR was employed to detect IRE1α mRNA expression levels.

A549/DDP cells were added to six-well plates at a density of 5x10³ cells/well. Cells were then transfected with 50 nM siRNA targeting RANKL (si-lncRNA RANKL, 5'-GCGACCAAUGUCAGGUCAUTT-3') or control siRNA (si-Control, 5'-AUGACCUGACAUUGGUCACTT-3'; both from Shanghai GenePharma, Co. Ltd.). Briefly, 50 nM siRNA was dissolved in 250 µl Opti-MEM medium containing 10 µl Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Each sample was thoroughly mixed and cultured for 5 min at 20˚C prior to the supplementation of the complex (500 µl in each well) for 48 h at 37˚C.