Total RNAs were isolated from roots, stems, leaves, flowers, and seeds at different development stages: 10, 20, 30, 40, 50, 60, 70, and 80 day after pollination (DAP) of reference cultivar Williams 82, and also isolated from the transgenic lines of each gene in Arabidopsis. Semi-quantitative RT-PCR was carried out on Applied Biosystems Veriti Thermal Cycler. The PCR conditions were 94°C for 3 min; 20-30 cycles of 94°C for 20 s, 60°C for 20 s, and 72°C for 20 s; followed by a final extension of 72°C for 10 min. Quantitative RT-PCR analyses were carried out on Applied Biosystems 7500 Real-Time PCR Systems by using the SYBR Green reagent (Takara) according to the manufacturer’s instructions. The PP2A gene (Protein Phosphatase 2A subunit A3, At1g13320) in Arabidopsis and the SUB3 gene (Soybean ubiquitin-3, Glyma20g27950) in soybean were used as the reference genes. The primer sequences used for RT-PCR were listed in Supplementary Table S2
7500 real time pcr system
Manufactured by Takara Bio
Sourced in Japan, China, United States
The 7500 Real-Time PCR System is a laboratory instrument designed for the amplification and detection of nucleic acid sequences using the polymerase chain reaction (PCR) technique. It provides real-time monitoring of the PCR process, allowing for quantitative analysis of target DNA or RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (17 mentions)
Primescript rt reagent kit, by Takara Bio (14 mentions)
Sybr premix ex taq, by Takara Bio (10 mentions)
Sybr premix ex taq kit, by Takara Bio (9 mentions)
Primescript rt master mix, by Takara Bio (6 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Sybr green master mix, by Takara Bio (3 mentions)
Tb green premix ex taq 2, by Takara Bio (3 mentions)
Trizol, by Takara Bio (3 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (3 mentions)
Rneasy ffpe rna kit, by Qiagen (3 mentions)
Omniscript rt kit, by Qiagen (3 mentions)
Sybr green pcr master mix, by Takara Bio (2 mentions)
Trizol plus kit, by Takara Bio (2 mentions)
Real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq tli rnaseh plus, by Takara Bio (2 mentions)
Two step reverse transcription reaction kit, by Takara Bio (2 mentions)
Dnase 1, by Takara Bio (2 mentions)
72 protocols using 7500 real time pcr system
1
Temporal Expression Profiling of Soybean and Arabidopsis
2
Quantitative Gene Expression Analysis in Cucumber
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative PCR (RT-qPCR) was employed for measuring transcript abundances. Total RNA was extracted from the young root, stem, leaf, male flower buds, female flower buds, fruit at anthesis, fruit pericarps, and tendril (Tiandz, http://www.tiandz.com , accessed on 6 May 2016), then reverse-transcribed by the PowerScriptTM reverse transcriptase (Invitrogen, Carlsbad, America). The ID number of the genes for RT-qPCR are listed in Supplemental Table S1 . The PCR amplification was performed on Applied Biosystems 7500 real-time PCR systems using SYBR Premix Ex Taq (TaKaRa, Osaka, Japan), with gene-specific primers listed in Supplemental Table S2 . The cucumber α-TUBULIN (TUA) gene was used as a reference control to normalize the expression data. RT-qPCR were repeated in three biological samples and the 2−∆∆Ct method was used for data analysis. The primers used are listed in Supplemental Table S2 .
3
Quantification of circRNA008876, osteogenic genes, and miR-150-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized with PrimeScript™ RT reagent Kit (Takara) using 1ug total RNA after gDNA was erased according to the manufacturer’s instructions. Applied Biosystems 7500 Real-Time PCR Systems was applied to perform amplification reaction using SYBR Premix Ex Taq (Takara). GAPDH and U6 were used as endogenous controls for circRNA008876, osteogenic genes and miR-150-5p expressions, respectively. The RNA expressions were analyzed by 2-△△CT method. The primer sequences were listed in Supplementary Table S1 .
4
Quantitative RT-PCR Analysis of miR-1286 and PKM2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol (Invitrogen, USA) and cDNA was synthesized using a PrimeScript RT reagent kit (Takara, Japan) according to the manufacturer’s instructions. Quantitative RT-PCR (qRT-PCR) was performed in an Applied Biosystems 7500 real-time PCR system (Foster City, CA, USA) through the application of SYBR Green PCR master mix (TaKaRa Biotechnology Co. Ltd). All quantitative RT-PCR reactions were performed in triplicate. The relative mRNA levels of miR-1286 and PKM2 were normalized against β-actin RNA. The corresponding PCR primers were as follows: PKM2 forward 5′-ATGTCGAAGCCCCATAGTGAA-3′ and reverse 5′-TGGGTGGTGAATCAATGTCCA-3′; β-actin was used as an internal control and was amplified using primers 5′-AGTGTGACGTTGACATCCGT-3′ and 5′- GCAGCTCAGTAACAGTCCGC-3′.
5
Quantification of ITGB1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using a TRIzol™ Plus Kit (Takara, Osaka, Japan) according to the manufacturer's instructions. Synthesized cDNA was prepared with a real-time PCR System (Life Technologies, Carlsbad, CA, USA) for qRT-PCR using an Applied Biosystems 7500 real-time PCR System with SYBR™ Green Master Mix (Takara, Osaka, Japan). The relative expression of ITGB1 was determined with the 2-△△Ct method after normalization to the expression of GAPDH. The primers for ITGB1 were: forward, 5′-AAATGTAACCAACCGTAGC-3′ and reverse, 5′-GACAGGTCCATAAGGTAGTAGA-3′.
6
Quantitative Analysis of Recombinant Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The transcription of bgl1A(A24S/F297Y) and SRRz was assessed via qRT-PCR during fermentation. Briefly, total mRNA of BL21(DE3)pLysS/ pET22b–pD-bgl1A(A24S/F297Y)-T7-SRRz was extracted using the RNeasy Mini Kit (Sangon Biotech., Shanghai, China) following the manufacturer’s instructions. The cDNA was amplified through reverse transcription, with the total mRNA as the templates. Specific primer pairs (Additional file 1 : Table S2) were designed using the Primer 5.0 software, and their specificities were confirmed by BLAST search against the E. coli BL21(DE3) genome. The 16 s rRNA gene was chosen as the control for normalization. qRT-PCR was performed in a 96-well plate in Applied Biosystems® 7500 Real Time PCR System using a SYBRs Premix Ex Taq TM II according to the manufacturer’s instructions (TaKaRa, Dalian, China). The obtained data were analyzed using the 2-ΔΔCT method [27 (link)].
7
Controlled Expression Profiling of Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression materials CSSL28 and 9311 were planted in an artificial climate chamber (model: XT5408-CC320TL2H, Xutemp Tech Compay, Hangzhou, China), and the humidity was stably controlled at 80% ± 5%.An 8-h light/12-h dark photocycle was used, and the temperature was controlled at ~ 28 °C.After 5 d of hydroponic culturing in a light incubator, the culturing was continued in a mixed nutrient soil, to ensure uniform growth conditions. Sampling was carried out at 5, 15 and 30 d of culturing. Liquid nitrogen was immediately injected to prevent RNA degradationafter sampling. RNA was extracted using TRIzol reagent (Invitrogen, CA, USA) and treated with DNase I (Invitrogen).cDNA was synthesized using SuperScript III Reverse Transcriptase (Invitrogen). A quantitative analysis of gene expression was performed on an Applied Biosystems 7500 Real-Time PCR System using SYBR Premix Ex Taq (TaKaRa, Otsu, Japan). Data were analyzed using a relative quantitative method [26 (link)]. Each real-time PCR reaction had three duplications, and the Actin gene of rice was used as an internal reference.
8
In vivo Gene Silencing in Mice
9
Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the PureLink Micro-to-Midi System (Invitrogen) according to the manufacturer’s instructions, and reverse transcription was used to generate cDNAs using the PrimeScript RT Reagent kit (TaKaRa). qPCR was performed using SYBR Premix Ex Taq (TaKaRa) and the 7,500 Real-Time PCR System. The reaction parameters were 95°C for 30 s, followed by 40 two-step cycles of 95°C for 5 s and 60°C for 34 s. Ct values were calculated using Sequence Detection System software, and the amount of target sequence normalized to the reference sequence was calculated as 2−ΔΔCt. All primers and probes were designed using Primer Premier 5.
10
Quantification of Notch Pathway Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the brain using TRIzol reagent, following the manufacturer’s protocol. Real-time PCR of 2-μl cDNA was used to determine the expression levels of Hes1, Hes5, Hey1, and Hey2 on an ABI 7500 Real-time PCR System with SYBR Premix Ex Taq mix (TaKaRa) in 20-μl reaction volumes. Relative levels of transcripts were calculated by normalizing to β-actin and wild-type (WT) mice (the mean expression of the WT mice was set to 100%) using the 2 − △△CT method. The primer sequences used are listed in Table 1 .
Primers used in real-time RT-PCR analysis
| Primer | Sequence (5′–3′) | Product length |
|---|---|---|
| Hes1-F | TCAACACGACACCGGACAAAC | 155 bp |
| Hes1-R | ATGCCGGGAGCTATCTTTCTT | |
| Hes5-F | CAGCCCGTAGAGGACTTTCTT | 103 bp |
| Hes5-R | GCAGTTCCGCCTTCACAA | |
| Hey1-F | CCGACGAGACCGAATCAATAAC | 125 bp |
| Hey1-R | TCAGGTGATCCACAGTCATCTG | |
| Hey2-F | AAAAGGCGTCGGGATCGAATA | 177 bp |
| Hey2-R | AGCATGGGCATCAAAGTAGCC | |
| β-actin-F | TACGCCAACACAGTGCTGTCTG | 200 bp |
| β-actin-R | CTGCTTGCTGATCCACATCTGC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!