Corpus callosum (cc) region of the brain was removed according to mouse brain atlas description (Sidman, et al. 1971). RNA was isolated from the cc by RNA isolation kit (Roche High Pure RNA Tissue Kit), and 1mg of RNA obtained. mRNA was converted to complementary DNA (cDNA) by using revert aid first strand cDNA synthesis kit (Roche). Primers for Cxcr4, Cntf and Nrg1 target genes and reference gene Gapdh1 were listed in Supplementary Table. Gene expression levels were calculated by delta delta Ct method.
Revertaid first strand cdna synthesis kit
Manufactured by Roche
Sourced in Switzerland, United States, Germany
The RevertAid First Strand cDNA Synthesis Kit is a laboratory reagent designed for the reverse transcription of RNA into complementary DNA (cDNA). It includes the necessary components to efficiently convert RNA into single-stranded cDNA, which can then be used for various downstream applications such as PCR, qPCR, or cloning.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Faststart universal sybr green master rox, by Roche (6 mentions)
Anti nf κb p65, by Cell Signaling Technology (5 mentions)
Anti gapdh, by Cell Signaling Technology (5 mentions)
Anti iκb, by Cell Signaling Technology (5 mentions)
Anti jak2, by Cell Signaling Technology (5 mentions)
Apc mouse anti human cd40, by BD (5 mentions)
Fitc mouse anti human cd23, by BD (5 mentions)
Faststart universal sybr green master, by Roche (4 mentions)
Lipopolysaccharide lps, by Merck Group (4 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Enhanced chemiluminescence ecl solution kit, by Merck Group (4 mentions)
Anti phospho jak2, by Cell Signaling Technology (4 mentions)
Anti phospho iκb, by Cell Signaling Technology (4 mentions)
Apc mouse anti human cd14, by BD (4 mentions)
Fitc mouse anti human cd86, by BD (4 mentions)
Apc mouse anti human cd16, by BD (4 mentions)
Fitc mouse anti human cd68, by BD (4 mentions)
Trizol reagent, by Roche (3 mentions)
Lightcycler faststart dna master sybr green 1 kit, by Roche (2 mentions)
31 protocols using revertaid first strand cdna synthesis kit
1
Corpus Callosum Gene Expression
2
Quantitative Analysis of IL-2 and IFN-γ Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the T cells by lysis using guanidinium isothiocyanate and phenol acid extraction. A total of 1 µg RNA, 0.5 µl RNase H minus (Promega Corporation) and 1 µl Moloney murine leukemia virus reverse transcriptase were used for cDNA synthesis with the following thermocycling conditions: 95°C 5 min; 95°C 15 sec, 60°C 35 sec, 40 cycles; 72°C 5 min; 4°C terminal. For each PCR, 2 µl cDNA was used and the primers were obtained from BD Biosciences. The primer sequences were as follows: IL-2 forward, 5′-GAATGGAATTAATAATTACAAGAATCCC-3′ and reverse, 5′-TGTTTCAGATCCCTTTAGTTCCAG-3′; and IFN-γ forward, 5′-TCGGTAACTGACTTGAATGTCCA-3′ and reverse, 5′-TCCTTTTTCGCTTCCCTGTTTT-3′. The Light Cycler-Fast Start DNA Master SYBR Green I kit (Roche Diagnostics) was used for the RT-qPCR analysis of IL-2, and the Revert Aid™ First Strand cDNA Synthesis kit (Roche Diagnostics) was used for IFN-γ, according to the manufacturer protocols. The quantitative analysis of original template was performed by the change of fluorescence of the amplification product.
3
Total RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells/tissues using Tripure (cat. no. 1667165001; Roche Diagnostics, Basel, Switzerland), and reverse transcription to cDNA was performed using the RevertAid First Strand cDNA Synthesis kit (cat. no. K1621; Fermentas; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Primer sequences (Table I ) were designed using the online software Primer3 (version 0.4.0; Whitehead Institute, Cambridge, MA, USA). Primer sequence specificity was verified using the Basic Local Alignment Search Tool (blast.ncbi.nlm.nih.gov/Blast.cgi ), and the primers were synthesized by Shanghai Bioengineering Co. (Shanghai, China). RT-PCR was performed according to the manufacturer's protocol (cat. no. k0221; Fermentas; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec. The primer annealing temperature was 60°C for all RT-PCR procedures performed. Data were analyzed according to the 2−ΔΔCq method (23 (link)), and all experiments were repeated three times.
4
Quantification of GBC mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the GBC tissues with TRIzol reagent (Life Technologies, Gaithersburg, MD, USA) and was reverse transcribed using the RevertAid First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). PCR was performed with Fast Start Universal SYBR Green Master Mix (Roche, Basel, Switzerland), and the fluorescence was measured using an ABI 7500 Real‐Time System (Applied Biosystems, Life Technologies) following the manufacturer's instructions, with GAPDH as an internal control. The data were analyzed using the −ΔΔCt method.
5
Molecular Mechanisms of LPS-Induced Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RPMI 1640 medium, fetal bovine serum (FBS), and phosphate-buffered saline (PBS) were procured from Hyclone. Lipopolysaccharide (LPS, From E. coli, Cat no: L-2630) was procured from Sigma (MO, USA). Primers for real-time reverse transcriptase–polymerase chain reaction (RT-PCR) and TRIzol (Cat no: 15596026) were purchased from Invitrogen. Revert Aid First-Strand cDNA Synthesis Kit (Cat no: k1621) and FastStart Universal SYBR Green Master (ROX) (Cat no: 4385610) were purchased from Roche. RIPA (Cat no: 9806S) and primary antibodies for Western blot analysis, including anti-IκB (Cat no: 76041S), anti-phospho-IκB (Ser32) (Cat no: 2859S), anti-NF-κB p65(Cat no: 8242S), anti- phospho-NF-κB p65(Ser536) (Cat no: 3033) anti-JAK2(Cat no: 3230S), anti-phospho-JAK2(Tyr1007/1008) (Cat no: 3771S), and anti-GAPDH (Cat no: 5174S), were purchased from Cell Signaling Technology. Secondary antibodies were obtained from Sigma. The Enhanced Chemiluminescence Solution Kit (Cat no: WBKLS0500) was obtained from Millipore (MA, USA). APC mouse anti-human CD16(Cat no: ab203883) and FITC mouse anti-human CD86(Cat no: ab213044) were purchased from Abcam (Cambs, UK). APC mouse anti-human CD40(Cat no: 555591) and FITC mouse anti-human CD23(Cat no: 561146) were purchased from BD Systems (BD Biosciences, USA).
6
Quantifying Long Non-Coding RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from cells and tissues using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions. First-strand cDNA was synthesized using a Revert Aid First Strand cDNA Synthesis Kit (Roche, USA). qRT-PCR analysis of lncRNAs was performed in an Applied Biosystems 7500 Fast Real-Time PCR system (Applied Biosystems, USA) using One-Step SYBR PrimeScript (Roche, USA) according to the manufacturer’s instructions. The primer sequences are shown in Table 5 .
Primers used for qRT-PCR
| Gene name | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| ENST00000608161 | AGCGTGTTCTCAGGAGCAGG | CACAGTTGCACAGACGACAGT |
| ENST00000609941 | GGACAAGTGCTCAGAATTGCAT | CTTTTACTTAAGAGAATCTTTGCGGG |
| ENST00000609697 | TGTGCTGTGTCCATCACCGA | TGATGCATTTATTACATTCCCAAAGCC |
| ENST00000443224 | AGTGAAACTGTTGTCATCCTTAGTT | AGACAGTTCTAAACCAGACAATGACA |
| ENST00000602992 | GACGCAGGGTGGTAGGGAAA | GGCTTCCCAGAGACACAAGC |
| ENST00000450016 | CACTGCACTCCAGCTTGGGA | TTAATTTTTACAACAGCTTCCGGGGGA |
| NR-024321 | TGGCTTGTCTTCCATCGTCC | GCACGAGGGTTGTTACAGGA |
| lnc-CDH1-5:1 | CGGTCGGGTATGAGGCACAT | GCGCTGTGTGCATGTTGTTTG |
| β-Actin | CTCCTTAATGTCACGCACGAT | CATGTACGTTGCTATCCAGGC |
7
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagents (Invitrogen). For mRNA analysis, 1 μg of total RNA was reverse transcribed by using a Revert Aid first strand cDNA synthesis kit (Roche). The cDNA was analyzed using Power SYBR green PCR master mix (Roche) with a Roche 480 system. The mRNA quantitative PCR data were normalized to Gapdh. Primer sequences are listed in Supplementary Table 1 .
8
Quantitative Analysis of Target mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify the mRNA of target genes by RT-qPCR, total RNA was extracted from MCF-10A, T-47D, MCF-7, and MDA-MB-231 cells using TRIzol reagent. Reverse transcription was performed using the RevertAid First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions. β-Actin was used as the internal reference. The relative expression of target genes was calculated using the 2−ΔΔCt method.
9
Quantitative Analysis of USP53 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (Roche). Reverse transcription of total RNA (2 μg) with a Revert Aid First Strand cDNA synthesis kit (Roche) according to the manufacturer's instructions. Β‐actin was selected as the internal control. The relative expression (RQ) was calculated as the fold change relative to an internal reference, which was based on the following equation: RQ = 2−ΔΔCt.
The primer sequences for USP53 were as follows: forward 5′‐GCCTAAATGCA AACAAAGTTGC‐3′ and reverse 5′‐TTTGTTCAGAAGGGCAGCTTGA‐3′. The primer sequences for the housekeeping gene β‐actin were as follows: forward 5′‐CATGTACGTTGCTATCCAGGC‐3′ and reverse 5′‐CTCCTTAATGTCACGCACG AT‐3′.
The primer sequences for USP53 were as follows: forward 5′‐GCCTAAATGCA AACAAAGTTGC‐3′ and reverse 5′‐TTTGTTCAGAAGGGCAGCTTGA‐3′. The primer sequences for the housekeeping gene β‐actin were as follows: forward 5′‐CATGTACGTTGCTATCCAGGC‐3′ and reverse 5′‐CTCCTTAATGTCACGCACG AT‐3′.
10
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
QRT-PCR were analyzed using an Applied Biosystems StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, United States). Total RNA from SAF and VAF tissues were isolated using TRIzol® Reagent (Invitrogen, Carlsbad, CA, United States); cDNAs were synthesized using a Thermo Scientific RevertAid First Strand Cdna Synthesis Kit; and QRT-PCR analyses were carried by using Roche FastStart Universal SYBR Green Master (Rox). Mrna primers were designed using Primer 5.0 software (Primer-E Ltd., Plymouth, United Kingdom) and their sequences are listed in Supplementary Tables S1–S2 . Parallel reactions using GAPDH were performed to normalize the amount of templated cDNA. Each of the amplifications was triplicated and the mean value was calculated using the △△Ct method. The results (FC) were expressed as 2△△Ct: , where Ctij and CtGAPDHj are the Ct values for gene I and for GAPDH in a sample (named j); Cti1 and CtGAPDH1 are the Ct values in sample 1, expressed as the standard. A Student’s t-test of independent data was used to assess the statistical significance of differential expression levels of each gene within the samples.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!