Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and cDNA synthesized using the PrimeScript RT reagent kit (Takara, Dalian, China). qPCR was performed using the Mastercycler Realplex2 detection system (Eppendorf, Hamburg, Germany) and SYBR Premix Ex Taq mixture (Takara). Primer sequences were: Hprt forward: 5′-GCTGGTGAAAAGGACCTCT-3′, reverse: 5′-CACAGGACTAGAACACCTGC -3′; Actin forward: 5′-CCTGTATGCCTCTGGTCGTA-3′, reverse: 5′-CCATCTCCTGCTCGAAGTCT-3′; Kap1 forward: 5′-CCTCGGCGGCCTCTGGTAG-3′, reverse: 5′-TGGCTGGGCATTATCTTCACA-3′. For expression analysis, all samples were normalized to actin signal.
Sybr premix ex taq mixture
Manufactured by Takara Bio
Sourced in Japan, United States
SYBR Premix Ex Taq mixture is a ready-to-use solution for real-time PCR amplification. It contains DNA polymerase, SYBR Green I dye, and reaction buffers.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Thermal cycler dice tp800 system, by Takara Bio (5 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Trizol, by Takara Bio (2 mentions)
Magextractor, by Toyobo (2 mentions)
Revertra ace, by Toyobo (2 mentions)
Mastercycler realplex2 detection system, by Eppendorf (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Lightcycler, by Roche (1 mentions)
Mastercycler ep realplex platform, by Eppendorf (1 mentions)
Sm7368, by Merck Group (1 mentions)
Polyvinylidene difluoride pvdf membrane, by Beyotime (1 mentions)
Horseradish peroxidase conjugated secondary antibody, by Beyotime (1 mentions)
Radioimmunoprecipitation assay (ripa), by Beyotime (1 mentions)
Cell counting kit 8 cck 8 reagent, by Dojindo Laboratories (1 mentions)
Sodium dodecyl sulfate polyacrylamide gel electrophoresis sds page, by Beyotime (1 mentions)
Abi 7500 pcr instrument, by Thermo Fisher Scientific (1 mentions)
Rna reverse transcriptase, by Promega (1 mentions)
Mirneasy kit, by Qiagen (1 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
17 protocols using sybr premix ex taq mixture
1
Quantitative RT-PCR Analysis of Gene Expression
2
Quantification of mRNA Levels in Rat Striatum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After anesthetization, the rats were killed by decapitation to prepare the total RNA extraction of lesioned striatum 1 h following the final treatment. The total RNA was acquired by using TRIzol reagent (Invitrogen, CA, United States). A measure o 1 μg of total RNA was reverse-transcribed to cDNA using 5 × PrimeScript RT Master Mix (Takara, Japan) in accordance with the manufacturer’s instruction. For PCR amplification, 10 mL reaction volume was used, including 5 mL of 2 × SYBR Premix Ex Taq mixture (Takara, Japan), 0.1 mmol/L of each primer, and 1 mL of twofold diluted cDNA and sterile distilled water. The reaction and detection were conducted in a light cycler (Roche, Mannheim, Germany). The 2–ΔΔCt method was used to calculate the relative mRNA levels of each target gene. The primers usen for TNF-α, IL-1β, IL-6, and iNOS were listed as follows: tnf-α (F) 5′-GACACCATGAGCACGGAAAG-3′, (R) 5′-TCCTCTGCCAGTTCCACATC-3′, Il-1β (F) 5′-CTGCCA AGTCAGGTCTCTCA-3′, (R) 5′-CCACTGCCTTCCCTACTT CA, Il-6 (F) 5′-CCACTGCCTTCCCTACTTCA-3′, (R) 5′-TGGT CTGTTGTGGGTGGTAT-3′, inos (F) 5′-ACCAGGAGGCGCCA TCCCGCTGC-3′, and (R) 5′-CTTGATCAAACACTCATTTT AT-3′. The cycle threshold (Ct) values were collected and normalized to the level of the housekeeping gene gapdh. The 2–ΔΔCt method was used to calculate the relative mRNA levels of each target gene.
3
Chondrocyte Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chondrocytes (1 × 105 in each well) cultured in a six-well plate were washed with cold PBS and incubated with TRIzol reagent to extract total RNA. cDNA was synthesized using 1 mg total RNA with a cDNA synthesis kit (MBI Fermantas, Germany). The primers of MMP3, -9 and-13, ADAMTS4 and-5, CCL-2 and-5, and CXCL1 are shown in Table 1 . tive mRNA levels of those genes were calculated using the 2−ΔΔCt method. Twenty microliters of reaction volume was prepared before amplification, including 2 μL of twofold diluted cDNA, 10 μL 2 × SYBR Premix Ex Taq mixture (Takara, Japan), 0.2 μM each primer, and sterile distilled water. The amplification reaction was performed on a Mastercycler® ep realplex platform (Eppendorf, Hamburg, Germany). After amplification, the cycle threshold (Ct) values were obtained and normalized to the value of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase. The relative mRNA levels of those genes were calculated using the 2−ΔΔCt method.
4
Investigating Autophagy Regulation in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CCK-8 (Cell Counting Kit-8) reagent was purchased from Dojindo (Tokyo, Japan). The autophagy protein 5 (ATG5), microtubule-associated protein light chain 3 (LC3), p-p65, p65, and IκBα primary antibodies for Western blotting were purchased from Cell Signaling Technology (Massachusetts, USA), and the other reagents used for Western blotting, including the horseradish peroxidase-conjugated secondary antibodies, radioimmunoprecipitation assay (RIPA), polyvinylidene difluoride (PVDF) membranes, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were obtained from Beyotime (Shanghai, China). The p65 primary antibody for immunofluorescence was supplied by Abcam (Cambridge, UK). Adenovirus expressing green fluorescent protein–microtubule-associated protein light chain 3(GFP–LC3) was purchased from Genomeditech (Shanghai, China). Acridine orange (AO), TNF-α, DHA, and SM7368 were purchased from Sigma-Aldrich (St. Louis, MO, USA).TRIzol and the SYBR Premix Ex Taq mixture were obtained from Takara (Takara Bio, Otsu, Japan).
5
Quantifying Fungal Growth in Soybean Roots
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative fungal growth of C. ilicicola (UH2-1) was detected using qPCR, as described previously10 (link). Briefly, genomic DNA was extracted from the whole root system using a MagExtractor (Toyobo, Osaka, Japan), following the manufacturer’s instructions. Three root samples were represented for each replicate, and there were four replicates for each treatment and three biological replicates (n = 36). Real-time qPCR was performed on a Thermal Cycler Dice TP800 system (Takara Bio. Inc., Otsu, Japan) using SYBR premix Ex Taq mixture (Takara) with cycles of 95 °C for 5 s, 55 °C for 20 s, and 72 °C for 20 s. Relative fungal growth was expressed as C. ilicicola rDNA amplification fold-relative to host β-actin gene amplification. The PCR primers used were (1) primers targeting the intergenic spacer region of the C. ilicicola rDNA: CiIGSF (forward) = 5′-TCCATTGCCTCTATTTATCCTGC-3′ and CiIGSR (reverse) = 5′-GCGTAAAGATTTTCCAACCCG-3′46 (link); (2) primers for soybean β-actin gene 11 (Glyma.15G050200): Gm-β-ActinF (forward) = 5′-GAGCTATGAATTGCCTGATGG-3′) and Gm-β-ActinR (reverse) = 5′-CGTTTCATGAATTCCAGTAGC-3′.
6
Quantifying Fungal Growth in Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative fungal growth was measured by quantitative real-time polymerase chain reaction (qPCR). All measurements were performed with three biological replicates, and each replicate consisted of five plants. Genomic DNA was extracted from plant tissues using MagExtractor (Toyobo, Osaka, Japan) following the manufacturer’s instructions. Real-time PCR was run on a Thermal Cycler Dice TP800 system (Takara Bio Inc., Otsu, Japan) using SYBR premix Ex Taq mixture (Takara) with cycles of 95°C for 5 s, 55°C for 20 s, and 72°C for 20 s. Three technical replicates were used for each biological replicate sample. The PCR primers used were as follows: (1) primers targeting the intergenic spacer region of the C. ilicicola rDNA, CiIGSF (forward) = 5′-TCCATTGCCTCTATTTATCCTGC-3′, and CiIGSR (reverse) = 5′-GCGTAAAGATTTTCCAACCCG-3′ (Ochi and Kuroda, 2021 (link)); (2) primers for soybean β-Actin gene (Gm-β-Actin; Glyma.15G050200), Gm-β-ActinF (forward) = 5′-GAGCTATGAATTGCCTGATGG-3′, and Gm-β-ActinR (reverse) = 5′-CGTTTCATGAATTCCAGTAGC-3′ (Sugano et al., 2013 (link)). Relative fungal growth was expressed as C. ilicicola rDNA amplification folds relative to the host actin gene amplification (Jiang et al., 2020 (link)).
7
Antioxidant Gene Expression in Fruit Flies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This experiment was designed to examine the effect of CSOL treatment on the mRNA levels of antioxidant genes in fruit flies. Male fruit flies (eclosion within 8 h) were randomly divided into 2 groups: the control and 0.06 mg/ml CSOL-treated group, and housed as described above. The fruit flies were collected on days 0, 15, 25, 35, 45 and 55. The mRNA levels of SOD1, SOD2 and CAT were quantified by quantitative PCR (qPCR) as described in our previous study (19 (link)). Briefly, total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA), 2 µg RNA was reverse transcribed into cDNA using RNA reverse transcriptase (Promega, Madison, WI, USA), and qPCR was performed using an Option Monitor 3 Real-Time PCR System (Bio-Rad, Hercules, CA, USA) on an ABI 7500 PCR instrument (Applied Biosystems, Carlsbad, CA, USA) with SYBR Premix Ex Taq™ Mixture (Takara, Otsu, Japan) following the manufacturer's instructions. The primers used were as follows: SOD1 sense, 5′-CTGCTCTGCTACGGTCACAC-3′ and antisense, 5′-ACAGCTTTAACCACCATTTCG-3′; SOD2 sense, 5′-CCACATCAACC ACACCATCT-3′ and antisense, 5′-CAGTTTGCCCGACTTCTTGT-3′; CAT sense, 5′-TTCGATGTCACCAAGGTCTG-3′ and antisense, 5′-TGCTCCACCTCAGCAAAGTA-3′; and RP49 sense, 5′-ACTTCATCCGCCACCAGTC-3′ and antisense, 5′-ATCT CGCCGCAGTAAACG-3′. RP49 was used as an internal control. The results were analyzed using the 2−ΔΔCt method.
8
Analyzing Rice Defense Responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rice seedlings at the four-leaf stage were blast-inoculated, and the inoculated fourth leaf blades of half the plants was cut off at 2 dpi. Sixth whole leaf was collected at 3 dpi, and leaf blades and leaf sheathes separately at 6 dpi. Three biological replicates were collected, four leaves in each replicate.
Real time-polymerase chain reaction (RT-PCR) was used to analyze the samples for expression of marker genes for JA (JAmyb and OMT), ABA (SalT and OsWsi18), auxin (ARF1 and IAA9), GA (OsGA2ox3 and OsGA20ox1) and SA (WRKY45 and OsNPR1), and PR genes OsPR1b and PBZ1. The genes and primer sequences used for qRT-PCR are listed in Supplementary Table1 .
Total RNA was isolated using the TRIzol reagent (Invitrogen) and reverse-transcribed by using ReverTra Ace (TOYOBO, Osaka, Japan) according to the manufacturer’s protocol. Quantitative RT-PCR (qRT-PCR) was run on a Thermal Cycler Dice TP800 system (Takara Bio) using SYBR premix ExTaq mixture (Takara Bio) as previously described (Shimono et al., 2007 (link)).
Real time-polymerase chain reaction (RT-PCR) was used to analyze the samples for expression of marker genes for JA (JAmyb and OMT), ABA (SalT and OsWsi18), auxin (ARF1 and IAA9), GA (OsGA2ox3 and OsGA20ox1) and SA (WRKY45 and OsNPR1), and PR genes OsPR1b and PBZ1. The genes and primer sequences used for qRT-PCR are listed in Supplementary Table
Total RNA was isolated using the TRIzol reagent (Invitrogen) and reverse-transcribed by using ReverTra Ace (TOYOBO, Osaka, Japan) according to the manufacturer’s protocol. Quantitative RT-PCR (qRT-PCR) was run on a Thermal Cycler Dice TP800 system (Takara Bio) using SYBR premix ExTaq mixture (Takara Bio) as previously described (Shimono et al., 2007 (link)).
9
Quantitative PCR Analysis of Rice Leaf Responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from rice leaves treated with chemicals as described above using Trizol reagent (Invitrogen). cDNA was synthesized using ReverTraAce (Toyobo, Tokyo, Japan). Quantitative PCR was run on a Thermal Cycler Dice TP800 system (Takara Bio, Tokyo, Japan) using the SYBR premix ExTaq mixture (Takara Bio) as described previously [9 (link)]. Sequences of primers used for RT-qPCR are listed in S1 Table .
10
Quantitative RT-PCR Analysis of Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the miRNeasy Kit QIAGEN (Qiagen, USA). One microgram of total RNA was used to synthesize cDNA (Takara, Shiga, Japan). For PCR amplification, a 20 mL reaction volume included 10 mL of 2× SYBR Premix Ex Taq mixture (Takara, Japan), 0.2 mmol/L of each primer, 2 mL of twofold diluted cDNA and sterile distilled water according to the manufacturer’s protocols. The cycle threshold (CT) values were collected and normalized to the housekeeping gene β-actin. The 2−△△CT was calculated to estimate the relative mRNA levels of each target gene. The primer sequences of the target gene are shown in Table 2 .
The primer sequences of target gene.
| Gene | Sequence (5′ to 3′) |
|---|---|
| m-IREB2-F | TTCTGCCTTACTCAATACGGGT |
| m-IREB2-R | AGGGCACTTCAACATTGCTCT |
| m-TFRC-F | GTTTCTGCCAGCCCCTTATTAT |
| m-TFRC-R | GCAAGGAAAGGATATGCAGCA |
| m-ATP5G3-F | TCTGCATCAGTGTTATCTCGGC |
| m-ATP5G3-R | CACCAGAACCAGCAACTCCTA |
| m-HMOX1-F | AAGCCGAGAATGCTGAGTTCA |
| m-HMOX1-R | GCCGTGTAGATATGGTACAAGGA |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!