PCR amplification of the ARHD genes from the plasmid clones was performed in 96‐well PCR plates in a final volume of 25 μl using the primers M13F (5′ CGC CAG GGT TTT CCC AGT CAC GAC 3′) and M13R (5′ TTT CAC ACA GGA AAC AGC TAT GAC 3′). PCR reaction contained 1X Taq buffer (Invitrogen), 1.5 mmol/L MgCl2, 0.2 mmol/L dNTP mix (GE Healthcare), 0.4 μmol/L of each primer, 2 U Platinum Taq DNA polymerase (Invitrogen) and 1 μl (10 ng/μl) of plasmid DNA. The reaction was conducted in an Eppendorf Mastercycler Gradient (Eppendorf Scientific, New York, USA) and the amplification program consisted of an initial denaturation at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 20 s and extension at 72°C for 90 s, and a final extension step at 72°C for 5 min. The PCR products were purified using the Illustra GFX 96 PCR Purification Kit (GE Healthcare Life Sciences) and checked on 1% agarose gel electrophoresis (Fisher Scientific, MA). The purified PCR products were then used as template for sequencing reaction using Big Dye kit (Life Technologies) and the primers M13R, according to manufacturer's guidelines. The sequencing of ARHD gene library was performed using the ABI 3500 XL platform (Applied Biosystems® 3500 XL).
Big dye kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Big Dye kit is a reagent used in DNA sequencing applications. It contains fluorescent dye-labeled nucleotides that are incorporated into DNA molecules during the sequencing process. The kit enables the detection and analysis of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Mastercycler gradient, by Eppendorf (1 mentions)
Taq buffer, by Thermo Fisher Scientific (1 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Dntp mix, by GE Healthcare (1 mentions)
Illustra gfx 96 pcr purification kit, by GE Healthcare (1 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Q solution, by Qiagen (1 mentions)
2 protocols using big dye kit
1
Amplification and Sequencing of ARHD Genes
2
Molecular Characterization of Buffalo MTRN1A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hair was collected from 77 buffaloes from the Terra Firme region in the State of Pará. DNA extraction was carried out using the phenol:chloroform:isoamyl alcohol method (25:24:1), according to the procedure outlined by Sambrook et al. (1989) . Polymerase chain reactions (PCRs) were carried out using a pair of primers that were designed based on the promoter region sequence and part of the MTRN1A exon 1 in sheep (GenBank accession No. AY524665; forward: TTTTTCATCTCTTACCATCTAG and reverse: GCGAGACGTTGAGCAGC). The final product of amplification was 810 bp.
For a final reaction volume of 15 µL, 10X PCR Buffer, 1 mmol MgCl 2 , 10 mmol each deoxyribonucleotide triphosphate (dNTP), 1 U Taq DNA Polymerase (Life Technology, Brazil), 20% Q-solution (Qiagen, Valencia, CA, USA), 50-100 ng genomic DNA, and ultrapure water were added. The initial denaturation temperature was set at 95°C for 10 min; followed by 30 cycles at 94°C for 1 min; 54°C for 1 min; and 72°C for 1 min. The final extension temperature was 72°C for 10 min.
The 77 PCR products were purified with the IllustraExoProStar 1-Step enzyme (GE Healthcare, UK) following the manufacturer protocols. The purified products were sequenced using the BIG DYE kit (Life Technology) in an ABI 3500 XL automatic DNA sequencer (Applied Biosystems, Foster City, CA, USA). The sequences were edited and aligned using the BioEdit software (Hall, 1999) .
For a final reaction volume of 15 µL, 10X PCR Buffer, 1 mmol MgCl 2 , 10 mmol each deoxyribonucleotide triphosphate (dNTP), 1 U Taq DNA Polymerase (Life Technology, Brazil), 20% Q-solution (Qiagen, Valencia, CA, USA), 50-100 ng genomic DNA, and ultrapure water were added. The initial denaturation temperature was set at 95°C for 10 min; followed by 30 cycles at 94°C for 1 min; 54°C for 1 min; and 72°C for 1 min. The final extension temperature was 72°C for 10 min.
The 77 PCR products were purified with the IllustraExoProStar 1-Step enzyme (GE Healthcare, UK) following the manufacturer protocols. The purified products were sequenced using the BIG DYE kit (Life Technology) in an ABI 3500 XL automatic DNA sequencer (Applied Biosystems, Foster City, CA, USA). The sequences were edited and aligned using the BioEdit software (Hall, 1999) .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!