Apricots were purchased from local market. Cadmium(ii ) chloride anhydrous, mercury(ii ) chloride, potassium dichromate were purchased from spectrochem ltd. Nickel(ii ) chloride hexahydrate, copper(ii ) chloride dihydrate were purchased from Fischer scientific. Iron(iii ) chloride, barium(ii ) nitrate, lead(ii ) acetate trihydrate, magnesium(ii ) sulphate heptahydrate, Chromium(iii ) oxide, Cobalt(iii ) chloride and citric acid were purchased from Qualigens. Iron(ii ) chloride tetrahydrate was purchased from Thomas baker, zinc(ii ) chloride and sodium hydroxide pellets from Merck chemicals, manganese sulphate monohydrate from SD fine chemical ltd., arsenic(iii ) oxide from Alfa aesar. Thioacetamide was procured from lobachem ltd. Sodium phosphate dibasic heptahydrate and sodium phosphate monobasic monohydrate were purchased from Loba chemicals. Deionized water was used throughout the experiments.
Copper ii chloride dihydrate
Manufactured by Thermo Fisher Scientific
Copper(II) chloride dihydrate is an inorganic chemical compound with the formula CuCl2·2H2O. It is a crystalline solid that is blue in color. Copper(II) chloride dihydrate is commonly used as a reagent in various laboratory applications.
Automatically generated - may contain errors
Lab products found in correlation
Nickel 2 chloride hexahydrate, by Thermo Fisher Scientific (1 mentions)
Potassium phosphate dibasic, by Thermo Fisher Scientific (1 mentions)
Oleic acid, by Merck Group (1 mentions)
Calcium chloride, by Thermo Fisher Scientific (1 mentions)
Citric acid, by Thermo Fisher Scientific (1 mentions)
Oleylamine, by Merck Group (1 mentions)
N n diisopropylethylamine, by Merck Group (1 mentions)
Hexadecylamine, by Merck Group (1 mentions)
Octadecene, by Merck Group (1 mentions)
2 protocols using copper ii chloride dihydrate
1
Apricot Heavy Metal Bioaccumulation
2
Synthesis of Colloidal Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oleylamine, colbalt chloride hexahydrate, trioctylyphosphine oxide (TOPO), trioctylyphosphine (TOP), hexadecylamine (HDA), silver nitrate (AgNO 3), oleic acid, octadecene, selenium (Se), sulphur, Trizma® acetate, N,N-diisopropylethylamine, poly(isobutylene-alt-maleic anhydride) and As (III) oxide were purchased from Merck. Citric acid and CTAB were purchased from Acros Organics. Myristic acid, n-octylamine, MES, indium chloride hydrate (InCl 3.H2O), potassium phosphate monobasic (KHPO 4), potassium phosphate dibasic (KH2PO4), zinc acetate dihydrate (ZnAc.2H2O), mercury (II) chloride, iron (II) chloride hexahydrate (FeCl 3.6H2O), gold (III) chloride trihydrate (HAuCl 4.3H2O), calcium chloride, silver nitrate (AgNO3), and copper (II) chloride dihydrate were purchased from Thermo Fisher. All other chemicals were used as received. Anti As (III)-Apt with the sequence: GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGC TCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT [33], was synthesized and purified by Merck.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!