Phenol chloroform extraction was used to preserve RNA integrity. Cells were trypsined and centrifuged at 200 × g for 10 min at 4 °C. Cell pellets were suspended in 1 mL of TRIzol™ Reagent (ThermoFisher), and 200 µL of chloroform were added. Samples were vortexed and centrifuged at 12000 × g for 15 min at 4 °C. The aqueous phase was collected, and RNA was precipitated with 1 volume of isopropanol. The pellets were washed with 70% ethanol, and RNA was dissolved in 50 µL H2O. To remove DNA contamination, an extensive DNase I treatment was performed. For this treatment, RNA was treated with 2 µL RNase-free DNase I (New England Biolabs) in a 50-µL volume including 5 µL 10X DNase I Reaction buffer, 1 µL RNase inhibitor, Murine (New England Biolabs), and H2O for 30 min at 37 °C. RNA was precipitated with Lithium Chloride Precipitation Solution (Invitrogen) according to the manufacturer’s protocol, and resuspended in 30 µL H2O. Genomic DNA extraction was performed using EZNA Tissue DNA kit (Omega) according to the manufacturer’s protocol. RNA and DNA were quantified by UV spectrometry using NanoDrop 1000 spectrophotometer (ThermoFisher).
Lithium chloride precipitation solution
Manufactured by Thermo Fisher Scientific
Sourced in France
Lithium Chloride Precipitation Solution is a laboratory product designed for the precipitation and purification of nucleic acids. It is a standardized solution that facilitates the selective precipitation of DNA and RNA, allowing for their efficient separation from impurities in various sample types.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Dnase 1, by New England Biolabs (2 mentions)
Rnase free dnase 1, by New England Biolabs (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
T25 flask, by Techno Plastic Products (1 mentions)
Magmax 96 ai nd viral rna isolation kit, by Thermo Fisher Scientific (1 mentions)
G block standard, by Integrated DNA Technologies (1 mentions)
Taqman fast advanced master mix virus, by Thermo Fisher Scientific (1 mentions)
Magmax pathogen rna dna kit, by Thermo Fisher Scientific (1 mentions)
Kingfisher flex purification system, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
P5288, by Merck Group (1 mentions)
M3148, by Merck Group (1 mentions)
4 protocols using lithium chloride precipitation solution
1
RNA and DNA Extraction Procedure
2
Isolating High-Quality RNA for TERRA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To perform this method, it is important to isolate high-quality RNA. We used phenol chloroform extraction to preserve RNA integrity. Cells grown in T-25 flasks (Techno Plastic Products, c Trassadigen, Switzerland) were centrifuged. Cell pellets were suspended in 1 mL of TRIzol™ Reagent (ThermoFisher), and 200 µL of chloroform was added. Samples were vortexed and centrifuged at 12,000× g for 15 min at 4 °C. The aqueous phase was collected, and RNA was precipitated with 1 volume of isopropanol. The pellets were washed with 70% ethanol, and RNA was dissolved in 50 µL H2O.
Since TERRA is present in small amounts in human telomerase-positive cell lines, it was essential to completely remove any DNA contamination using an extensive DNase I treatment. For this, 40 µg RNA (digestion was incomplete if a higher amount of RNA was used) were treated with 2 µL RNase-free DNase I (New England Biolabs, Evry, France ) in a 50 µL volume, including 5 µL 10× DNase I Reaction buffer, 1 µL RNase Inhibitor, Murine (New England Biolabs) for 30 min at 37 °C. RNA was precipitated with Lithium Chloride Precipitation Solution (Invitrogen), according to the manufacturer’s protocol, resuspended in 30 µL H2O, and quantified by UV spectrometry (Nanodrop, Thermo Fisher, Illkirch, France ).
Since TERRA is present in small amounts in human telomerase-positive cell lines, it was essential to completely remove any DNA contamination using an extensive DNase I treatment. For this, 40 µg RNA (digestion was incomplete if a higher amount of RNA was used) were treated with 2 µL RNase-free DNase I (New England Biolabs, Evry, France ) in a 50 µL volume, including 5 µL 10× DNase I Reaction buffer, 1 µL RNase Inhibitor, Murine (New England Biolabs) for 30 min at 37 °C. RNA was precipitated with Lithium Chloride Precipitation Solution (Invitrogen), according to the manufacturer’s protocol, resuspended in 30 µL H2O, and quantified by UV spectrometry (Nanodrop, Thermo Fisher, Illkirch, France ).
3
Quantitative SARS-CoV-2 Detection in Feces
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Inoculum was prepared using homogenized intestines or feces that were centrifuged at 14,000 rpm for 2 min and then 0.22 μm-filtered5 . To quantitate virus levels, RNA was extracted using the MagMAX-96 AI/ND Viral RNA Isolation Kit (Thermo Fisher Scientific) for feces and filtrates or the MagMAX Pathogen RNA/DNA Kit (Thermo Fisher Scientific) for tissues using the KingFisher Flex Purification System (Thermo Fisher Scientific). For experiments using DSS, lithium chloride precipitation solution (Thermo Fisher Scientific) was used according to the manufacturer’s guidelines in order to remove any remaining DSS from RNA samples and prevent inhibition of downstream PCR assays. Copies of the MuAstV genome were quantified using a G-block standard (Integrated DNA Technologies) in a one-step qRT-PCR using TaqMan Fast Advanced Master Mix Virus (Applied Biosystems) with primers (F: TACATCGAGCGGGTGGTCGC, R: GTGTCACTAACGCGCACCTTTTCA) and probe ((6-FAM)-TTTGGCATGTGGGTTAA-(MBGNFQ) under the following conditions: 50 °C for 5 min, 95 °C for 20 s followed by 40 cycles of 95 °C for 3 s and 60 °C for 30 s on a BioRad CFX96 Real Time System5 ,38 (link),39 (link).
4
Temporal Dynamics of Bark Transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bark was harvested 3 h, 6 h, 24 h, 72 h, 1 week and 4 weeks after treatment, from the first stem internode of four seedlings per treatment (water and MeJA). Each seedling was treated as a separate sample, therefore each treatment (e.g., MeJA treated) had four replicates for each harvest time. Immediately following harvesting the bark samples were flash frozen in liquid nitrogen and then stored at −80°C. Using a pestle and mortar, all bark samples were later ground to a powder in liquid nitrogen. For the samples collected 4 weeks posttreatment only half of the harvested bark was ground to a powder.
Total RNA was extracted from 30 to 50 mg of bark powder per sample using the MasterPure Complete DNA and RNA Purification Kit (Lucigen, MC85200). To denature ribonucleases and reduce polyphenolic contamination of extracted nucleic acids, 0.5% β‐mercaptoethanol (Sigma‐Aldrich, M3148) and 1% polyvinylpyrrolidone (PVP; Sigma‐Aldrich, P‐5288) were added to the extraction buffer. To reduce carbohydrate contamination, nucleic acids were precipitated using 0.5 volumes of 7.5 M lithium chloride precipitation solution (ThermoFisher Scientific, AM9480), subject to an incubation step at −20°C for 2 h, and centrifuged for 30 min at 16 500 × g and 4°C. Nucleic acids were resuspended in 60 μl of nuclease‐free water.
Total RNA was extracted from 30 to 50 mg of bark powder per sample using the MasterPure Complete DNA and RNA Purification Kit (Lucigen, MC85200). To denature ribonucleases and reduce polyphenolic contamination of extracted nucleic acids, 0.5% β‐mercaptoethanol (Sigma‐Aldrich, M3148) and 1% polyvinylpyrrolidone (PVP; Sigma‐Aldrich, P‐5288) were added to the extraction buffer. To reduce carbohydrate contamination, nucleic acids were precipitated using 0.5 volumes of 7.5 M lithium chloride precipitation solution (ThermoFisher Scientific, AM9480), subject to an incubation step at −20°C for 2 h, and centrifuged for 30 min at 16 500 × g and 4°C. Nucleic acids were resuspended in 60 μl of nuclease‐free water.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!