Primer express v2

Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and cDNA was synthesized using the Reverse Transcription kit (Promega, Madison, WI, USA). qRT-PCR was performed to quantify ROCK1 mRNA level with the SYBR Green PCR core Reagent kit (Applied Biosystems, Foster city, CA, USA). GAPDH was used as the endogenous reference. Data were analyzed by using the comparative Ct method. Specificity of resulting PCR products was confirmed by melting curves. The primers were designed using Primer Express v2.0 software (Applied Biosystems, Foster City, CA, USA). The primers used in this assay were: ROCK1 forward 5′-AGG AAG GCG GAC ATA TTA GTC CCT-3′ and reverse 5′-AGA CGA TAG TTG GGT CCC GGC-3′, β-actin forward 5′-TGA CGT GGA CAT CCG CAA AG-3′ and reverse 5′-CTG GAA GGT GGA CAG CGA GG-3′.

Total RNA from tissues and cultured cell lines was isolated using the Trizol reagent (Invitrogen) according to the manufacturer’s instruction. Primers for real-time RT-PCR were designed using Primer Express v2.0 software (Applied BioSystems). Sequences of the primers are summarized in Additional file 1: Table S3. RT was carried out with the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) according to the manufacturer’s protocol. Real-time PCR was carried out using SYBR Green I (Applied BioSystems). The data were normalized to the geometric mean of housekeeping gene GAPDH and calculated as 2^−ΔΔCT.

Total RNA from cultured cell and surgically obtained human tissues was extracted using the Trizol reagents according to the manufacturer's instruction. Real-time reverse transcription-polymerase chain reaction (PCR) primers were designed with the assistance of the Primer Express v 2.0 software (Applied BioSystems, Foster, CA). Sequences of the primers are: GRK6, 5′-GCTCCCTTCTTTTAAGGGTTCAA-3′ (forward); GRK6, 5′-ACCAGTAACTGTGACTCCGGT-3′ (reverse); GAPDH, 5′-GACTCATGACCACAGTCCATGC-3′ (forward); GAPDH, 5′-AG-AGGCAGGGATGATGTTCT G-3′ (reverse). Cyclin B1 5′-AGGAAGAGCAAGCAGTC AGAC-3′ (forward), 5′-GCAGCATCTTCTTGGGCAC AC-3′ (reverse); Cyclin D1, 5′-CTGGCCATGAACTAC CTGGA-3′ (forward), 5′-GTCACACTTGATCACTCTG G-3′ (reverse); Cyclin E, 5′-GTTATAAGGGAGACGGGG AG-3′ (forward), 5′-TGCTCTGCTTCTTACCGCTC-3′ (reverse); p21, 5′-AGTGGACAGCGAGCAGCTGA-3′ (forward), 5′-TAGAAATCTGTCATGCTGGTCTG-3′ (reverse). The products were analyzed on a 1.5% agarose gel containing 0.2 μg/mL ethidium bromide, and visualized under an ultraviolet transilluminator. Densitometric analysis of PCR products was performed with ImageJ software, and standardized to the GAPDH product.

The mtDNA content was determined using a 7900HT Sequence Detection Systems (Applied Biosystems) in duplicate. PCR primers for “specific gene” were designed using Primer Express V.2.0 software (Applied Biosystems Inc., Foster City, CA) based on the specific sequences from GenBank. The mitochondrial cytochrome b gene forward primers were 5- CATCATTGGACAAGTAGCATCCGTAC -3, and the reverse primer was 5- TTTCATCTCCGGTTTACAAGACTG -3. The mtDNA content was corrected by simultaneously measuring nuclear DNA. The RNase P gene is a single-copy gene that encodes the RNA moiety for the RNase P enzyme. The RNase P gene forward primers were 5- AGCCATCTTGAGAATATGTAGCAGG -3, and the reverse primer was 5- ATTTTTGCTCCATCGGTCTCTC -3. The thermal cycling conditions for real-time PCR were 50°C for 2 mins, then 95°C for 10 mins, and 40 cycles of denature (95°C, 15 secs) and annealing/extension (60°C, 60 secs). After PCR cycles, dissociation curve examination was performed. The amount of mtDNA was expressed relative to the quantity of RNAse P (2^(-ΔCT)) and in terms of ΔCT values calculated by using sequence detector software version 2.3. A second area of the genome was selected to confirm the accuracy of the results (S1 File).

NRN1 expression was evaluated by qPCR using the SYBR Green PCR Master Mix (Applied Biosystems Inc., Carlsbad, CA, USA). Total RNA was isolated from endometriotic tissues from the treated and untreated groups using the TRIzol method (Invitrogen, Carlsbad, CA, USA). Assessment of both RNA concentration and the purity in the extracted samples was done using Nanodrop, and A260/A280 ratio was more than 1.9 for each sample. cDNA synthesis was performed with a reverse transcription kit (Invitrogen). The TATA-box-binding protein (TBP) gene was used as an internal control. The oligonucleotide primers that were used for the amplification of NRN1 (forward: 5′-GCGACAGCATGGCCAACTAC-3′; reverse: 5′-CCTTCCTGGCAATCCGTAAGG-3′) and TBP (forward: 5′-TGCACAGGAGCCAAGAGTGAA-3′, reverse: 5′-CACATCACAGCTCCCCACCA-3′) were designed using the Primer Express v2.0 Software (Applied Biosystems Inc., Foster City, CA, USA). The relative expression level of NRN1 was compared to that of the internal control. Experiments were performed in duplicate.

Total RNA samples were extracted from cultured cells and primary tumour tissues using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions and treated with RNase-free DNase. cDNA was synthesized from 2 μg of RNA from each sample using an iScript™ cDNA Synthesis Kit (BioRad Laboratories, Hercules, CA, USA). The RT-PCR cycling conditions incorporated an initial denaturation at 94 °C for 5 min, followed by 30 denaturation cycles at 94 °C for 30 s, primer annealing at 55 °C for 30 s, primer extension phase at 72 °C 50 s, and a final extension step at 72 °C for 7 min. The primers for SLP-2 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed using Primer Express v 2.0 software (Applied Biosystems). The sequences of the primers were as follows: forward primer 5’-GTGACTCTCGACAATGTAAC-3’ and reverse primer 5’-TGATCTCATAACGGAGGCAG -3’. SLP-2 expression data were normalized to GAPDH, and all experiments were performed in triplicate.