Il 12p40

Lung homogenates were centrifuged, and the supernatants were collected. Filtered cell-free lung homogenates were used to detect IL-1α, IGF-1, IL-13, CCL3, CCL5, CXCL1, CXCL2 (R&D Systems), IL-2, TGF-β, IL-4, IL-5, IL-6, IL-12p40, IFN-γ, CCL2 (B&D Biosciences), IL-10, IL-17, IFN-β, TNF and GM-CSF (Biolegend) by enzyme-linked immunosorbent assay (ELISA).

Secretion of IL-12p40, IL-10, TNF, IL-6, and MCP-I (BD Biosciences) was determined in medium from cultured BMDMs or in murine blood serum using a sandwich enzyme-linked immune sorbent assay (ELISA). All assays were performed according to the manufacturer’s instructions. Triplicate samples were analysed using an ELISA reader and compared to a standard curve.

PBMCs were prepared from buffy coats by density gradient centrifugation, as previously described [21 (link)]. THP-1 cells were electroporated with a plasmid expressing EF1α promoter-driven Cas9-NLS-2A-EGFP and U6-driven guide RNA targeting BATF2 [CGGGTTCCTGTTACCCAGCTC], sorted for eGFP-positive cells, and selected via limited dilution, as previously described [22 (link)]. Genotypes were validated by Sanger sequencing (Figure S1). PBMCs and THP-1 cells were stimulated with herring testes DNA (dsDNA; Sigma-Aldrich/Merck, Darmstadt, Germany), 3pdsRNA, generated by in vitro transcription, as previously described [23 (link)], 9.2s RNA (Biomers, Ulm, Germany), Pam3CysK4, ultrapure LPS, flagellin, R848, and CpG2216 (all from InvivoGen, Toulouse, France), as indicated. Prior to stimulation, dsDNA and 3pdsRNA were complexed with Lipofectamine 2000 (Invitrogen/Thermo Scientific, Waltham, MA, USA), and 9.2 s RNA was complexed with poly-L-Arginin (Sigma-Aldrich/Merck, Darmstadt, Germany). Cellular supernatants were then harvested for ELISA probing for IFN-α, IFN-β (Hölzel Diagnostika, Cologne, Germany), TNF, IL-12p40, CXCL10, IL-8, IL-6 (BD Biosciences, Franklin Lakes, NJ, USA), and IL-23 (Human IL-23 HTRF Kit, CisBio, Codolet, France). RNA was isolated, as previously described [24 (link)].

Mouse IFN-γ (R&D Systems) and IL-12p40 (BD Biosciences) ELISA kits were used according to the manufacturer’s protocols to determine cytokine concentrations in mouse serum. Serum concentrations of IL-4 were determined using a sandwich ELISA. Maxisorp plates (Nunc) were coated with anti-mouse IL-4 capture antibody (2 µg/mL; 11B11; BioLegend) in 50 mM sodium bicarbonate buffer (pH 9.4) overnight. Plates were washed with 0.05% Tween 20 (Sigma-Aldrich) in PBS, blocked with 4% bovine serum albumin (BSA; Roche) in PBS for 2 h, and then samples and standards (mouse rIL-4; Peprotech), serially diluted two-fold from 2,000 pg/mL, were added for 1 h. Anti-mouse IL-4 detection antibody (0.5 µg/mL; BVD6-24G2, BioLegend) diluted in 4% BSA in PBS was added for 1 h, followed by HRP-conjugated streptavidin (2 µg/mL; Sigma-Aldrich) for 30 min. The plates were developed with TMB substrate (BD Biosciences), and the reaction stopped with 1 M H₂SO₄ (Sigma-Aldrich).

Cell-free supernatants were harvested and analyzed for levels of TNFα, IL-6, and IL-12p40 (BD Biosciences, Heidelberg, Germany) by ELISA according to the manufacturer's instructions. For evaluation of systemic cytokine levels in mice at indicated time points, whole mouse blood was transferred to microtubes with serum gel containing a clotting activator (Sarstedt, Nümbrecht, Germany), left undisturbed for 30 min and then centrifuged for 10 min at 10,000 g to harvest the serum. Serum cytokine profile was determined using either ELISA, the LEGENDplex mouse inflammation panel (Biolegend, San Diego, CA), or a Luminex-based multiplex assay (Bio-Rad, Hercules, USA) according to the manufacturer's instructions.