Trizol (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA of the six gastric cell lines and HEK293T, and then, reverse transcription was performed using Superscript II reverse transcriptase (Toyobo, Japan). Quantitative PCR amplification was finished using SYBR Green (Toyobo, Japan) on a CFX384 real‐time PCR machine (Bio‐Rad, Richmond, CA, USA). The primer of HACE1 for qPCR was produced by Boshang Biotech Company, Shanghai, China, and GAPDH which was used as normal control. The primer sequences of each gene were as follows: HACE1: 5′‐GAGAGAGCGATGGAGCAACT‐3′ and 5′‐ACAGCAAAACCAAGCATTCC‐3′; GAPDH: 5′‐GAGTCAACGGATTTGGTCGT‐3′ and 5′‐TGGAAGATGGTGATGGGATT‐3′.
Superscript 2 reverse transcriptase
Manufactured by Toyobo
Sourced in Japan
Superscript II reverse transcriptase is a laboratory reagent used for the synthesis of complementary DNA (cDNA) from RNA templates. It is a thermostable enzyme that catalyzes the reverse transcription process, converting single-stranded RNA into double-stranded cDNA for further molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green, by Toyobo (2 mentions)
Cfx384 real time pcr machine, by Bio-Rad (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time pcr machine, by Bio-Rad (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
Random primer, by Toyobo (1 mentions)
Abi 7900ht sequence detection system with sybr green dye, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Mirneasy kit, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (1 mentions)
4 protocols using superscript 2 reverse transcriptase
1
Quantification of HACE1 Expression in Gastric Cell Lines
2
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the L-02 cell line using an RNA simple Total RNA Kit (Tiangen, Beijing, China). Then, cDNA was produced using Superscript II reverse transcriptase (TOYOBO). Quantitative PCR amplification was subsequently performed on a CFX96 real-time PCR machine (Bio-Rad, Hercules, CA, USA) using SYBR Green (TOYOBO). GAPDH was used to normalize the relative abundances of the indicated genes. The primer sequences are presented in Table S2 .
3
Quantitative Real-Time PCR Analysis of Hub Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from the tissue samples according to the manufacturer’s protocol. Superscript II reverse transcriptase and random primers were used to synthesize cDNA (Toyobo, Osaka, Japan). Quantitative real-time PCR (qRT-PCR) was conducted on the ABI 7900HT Sequence Detection System with SYBR-Green dye (Applied Biosystems, Foster City, CA, USA; Toyobo, Osaka, Japan). The reaction parameters included a denaturation program (5 min at 95 °C), followed by an amplification and quantification program over 40 cycles (15 s at 95°C and 45 s at 65°C). Each sample was tested in triplicates, and each sample underwent a melting curve analysis to check for the specificity of amplification. Table 1 illustrates the primer sequences of hub genes. The expression level was determined as a ratio between the hub genes and the internal control GAPDH in the same mRNA sample, and calculated by the comparative CT method. Levels of COL1A2, COL1A1, COL4A1, THBS2 and ITGA5 expression were calculated by the 2−ΔΔCt method.
4
Brain Region Dissection and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Brain regions including the prefrontal cortex (Pfc), thalamus (Tha), hypothalamus (Hyp), hippocampus (Hip), periaqueductal gray (PAG), and ventral tegmental area (VTA) were dissected on a mouse Plexiglas brain mold using the atlas of Paxinos and Franklin [40] as a reference (Fig. S2). The spinal cord (Spc) from L1 to L5 was also dissected. The dissected tissues were immediately homogenized in TRIzol Reagent (TaKaRa). The homogenates were stored at -80°C until further RNA isolation. 2-3 mice were pooled for each region, and a total of 8-10 mice used for each gender. Total RNAs were extracted using miRNeasy kit (TaKaRa) following manufacture protocol. RNA concentrations were determined using a Qubit 2.0 Fluorometer (Invitrogen). RNAs were first treated with TurboDNA free reagent (TOYOBO) following the manufacture's protocol to remove potentially contaminating genomic DNA, and reverse transcribed with Superscript II reverse transcriptase (TOYOBO) and random hexmers. The first-strand cDNA was then used as templates in SYBR qPCRs.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!