Light cycler dna master sybr green 1 mix

Total RNA was extracted using Trizol reagent, and miRNAs from both cultured cells and FFPE specimens were obtained using mirVana miRNA Isolation Kit (Ambion, USA). Affymetrix GeneChip miRNA 2.0 Array including probes for 1105 mature human miRNA sequences was performed by a service provider (CapitalBio, Beijing, China).
The expression level of miR-29c was quantified by the stem-loop qRT-PCR method. The cDNA was prepared from total RNA (2 ug) with the miR-29c stem-loop RT primers or U6 RT primers (RiboBio, China) by using the First-Strand cDNA Synthesis kit (Promega, USA). U6 small nuclear RNA was used as an internal control for miR-29c. For quantification of VEGFA, the RNA was reversely transcribed into cDNA with the First-Strand cDNA Synthesis kit (Promega, USA) using oligo primers. Primer sequences of VEGFA were as follows: forward: 5’-CGCAGCTACTGCCATCCAAT-3’; reverse: 5’-GTGAGGTTTGATCCGCATAATCT-3’. β-actin mRNA was used as an internal control for VEGFA transcript. Then, the qRT-PCR was conducted using Light Cycler DNA Master SYBR Green I Mix (Roche, Switzerland) on an ABI Prizm 7300 Sequence Detection System. The miR-29c and VEGFA mRNA were quantified with the 2^-ΔΔCt method and normalized with the level of the internal control, respectively.

cDNA was prepared from 100 ng of total RNA with specific primers for miR-886-3p, miR-150 or U6 as the internal control. For the detection of mature miRNAs, quantitative miRNA RT-PCR was performed using the stem-loop qRT-PCR method [26] (link). The oligos used included the miRNA common reverse primer, GTGCAGGGTCCGAGGT; miR-150, TCTCCCAACCCTTGTACCAGTG; miR-150 RT primer, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACTGG; miR-150 forward primer, GTCTCCCAACCCTTGTACCA; miR-886-3p, CGCGGGTGCTTACTGACCCTT; miR-886-3p RT primer, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGGGT; miR-886-3p forward primer, CACGCGGGTGCTTACTGAC; U6 forward primer, CTCGCTTCGGCAGCACA; and U6 reverse primer, AACGCTTCACGAATTTGCGT. qRT-PCR was performed using an ABI Prizm 7300 Sequence Detection System with LightCycler DNA Master SYBR Green I mix (Roche Molecular Biochemicals, Mannheim, Germany) following the manufacturer's instructions. The level of miRNAs was determined using the 2^–ΔΔCt method with SDS 1.3 software, normalized to the level of the internal control, U6, and plotted for inter-cellular comparison.

Total RNA from cell lines was isolated using TRI Reagent^® (Sigma) according to manufacturer’s instructions. Contaminant genomic DNA was eliminated with TURBO DNA-free kit (Ambion). Real-time PCR was performed using the LightCycler^® DNA Master SYBR Green I mix (Roche) supplemented with 0.2 μM specific primer pairs (Table S6) and analysed by the comparative CT(ΔΔCT) method using U6 RNA as an invariant RNA. Each data shown in RT-qPCR analysis is the result of at least three independent experiments performed on at least three independent RNA extractions.