The largest database of trusted experimental protocols

One step tb green primescript rt qpcr kit 2

Manufactured by Takara Bio
Sourced in China

The One Step TB Green PrimeScript RT-qPCR Kit II is a reagent kit designed for reverse transcription and real-time PCR amplification of RNA targets. It contains all the necessary components for performing one-step RT-qPCR reactions, including a reverse transcriptase enzyme and a DNA polymerase.

Automatically generated - may contain errors

2 protocols using one step tb green primescript rt qpcr kit 2

1

SARS-CoV-2 RNA Extraction and RT-qPCR Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
200 μL of the supernatant was harvested from cells infected with SARS-CoV-2 and mixed with equal volume of lysis buffer provided in the high pure viral RNA kit (Invitrogen) and RNA was extracted according to the kit's instructions. The eluted RNA was subjected to RT-qPCR by using the One Step TB Green PrimeScript RT-qPCR Kit II (Takara) and specific primers targeting the SARS-CoV-2 nucleocapsid protein (NP):
Forward, 5′-TAATCAGACAAGGAACTGATTA-3′;
Reverse, 5′-CGAAGGTGTGACTTCCATG-3′.
RT-qPCR cycling conditions were 42 °C for 5 min, 95 °C for 10 s, and 40 cycles of 95 °C for 5 s, followed by 60 °C for 30 s.
All the SARS-CoV-2 based experiments were performed at the UCLA BSL3 facility.
+ Open protocol
+ Expand
2

Quantifying Viral RNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from heart, liver, spleen, lung, and kidney tissues and whole blood samples using the TRIzol reagent (Thermo Fisher, United States). RT-qPCR was used to quantify viral RNA by using One Step TB Green PrimeScript™ RT-qPCR Kit II (Takara, Dalian, China), according to the manufacturer’s instructions, using the following cycling program: 42°C for 5 min, 95°C for 10 s, and 40 cycles of 95°C for 5 s and 60°C for 30 s. The primers used in this work were as follows: VSV N gene (F: TAAACATCGGGAAAGCAG, R: GGTTGCCTTTGTATCTACTTG) and β-actin (F: CTGGCACCACACCTTCTACAATGAG, R: TGGCGTGAGGGAGAGCATAGC).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!