Total RNA was extracted using TRIzol® reagent (Takara Bio Inc., Otsu, Japan) and reverse‐transcribed to cDNA using PrimeScript™ RT Master Mix (Takara Bio Inc.). The relative mRNA expression levels were determined by a quantitative RT‐PCR with SYBR® Premix Ex Taq™ PCR kit (Takara Bio Inc.) on an ABI PRISM® 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The relative mRNA levels were calculated by the 2−ΔΔCq method with GAPDH as the internal control. The sequences of the primers used were: snail (forward) 5′‐TCGGAAGCCTAACTACAGCGA‐3′, snail (reverse) 5′‐AGATGAGCATTGGCAGCGAG‐3′; slug (forward) 5′‐CGAACTGGACACACATACAGTG‐3′, slug (reverse) 5′‐CTGAGGATCTCTGGTTGTGGT‐3′; twist1 (forward) 5′‐GTCCGCAGTCTTACGAGGAG‐3′, twist1 (reverse) 5′‐GCTTGAGGGTCTGAATCTTGCT‐3′; zeb1 (forward) 5′‐GATGATGAATGCGAGTCAGATGC‐3′, zeb1 (reverse) 5′‐ACAGCAGTGTCTTGTTGTTGT‐3′; zeb2 (forward) 5′‐CAAGAGGCGCAAACAAGCC‐3′, zeb2 (reverse) 5′‐GGTTGGCAATACCGTCATCC‐3′; GAPDH (forward) 5′‐CTCACCGGATGCACCAATGTT‐3′, GAPDH (reverse) 5′‐CGCGTTGCTCACAATGTTCAT‐3′.
Sybr premix ex taq pcr kit
Manufactured by Takara Bio
Sourced in Japan, China, United States
SYBR® Premix Ex Taq™ PCR kit is a ready-to-use master mix for real-time PCR amplification. It contains SYBR® Green I dye, Taq DNA polymerase, and necessary reagents for efficient and sensitive real-time PCR.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Abi 7500 machine, by Thermo Fisher Scientific (3 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (3 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Reverse transcription reagent, by Takara Bio (2 mentions)
Abi prism 7300 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Primescript real time reagent kit, by Takara Bio (1 mentions)
Sensifast cdna synthesis kit, by Meridian Bioscience (1 mentions)
Lightcycler system, by Roche (1 mentions)
Primescript rt reagent kit, by Bio-Rad (1 mentions)
Infinite m200, by Tecan (1 mentions)
Viia7, by Thermo Fisher Scientific (1 mentions)
Sds software package, by Thermo Fisher Scientific (1 mentions)
Abi 7500 system, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Lightcycler, by Roche (1 mentions)
19 protocols using sybr premix ex taq pcr kit
1
Quantitative RT-PCR Analysis of EMT Markers
2
Quantitative miRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miRNAs were extracted with the QIAGEN miRNeasy Mini Kit (QIAGEN) and reverse‐transcribed using PrimeScript™ RT Master Mix (Takara Bio Inc). The primers for reverse transcription are presented in Table S2 . RT‐qPCR was performed with the SYBR® Premix Ex Taq™ PCR kit (Takara) with U6 as the internal control. Specific primers are presented in Table S3 .
3
Quantitative Analysis of Bone-Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of bone-related genes, including ALP, osteopontin (OPN), collagen type I (COLI), and osteocalcin (OCN), were quantitatively tested by real-time polymerase chain reaction (PCR) with diaminopimelate dehydrogenase (DAPDH) as the housekeeping gene for normalisation. The forward and reverse primers for different genes are listed in Adhesive strength. At 7, 14, and 21 days after culturing, the total RNA from the cell lysates were extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) in terms of the manufacturer's protocol. The reverse transcription was carried out by PrimeScript® real time (RT) reagent kit (Takara Bio-technology Co., Dalian, China). The quantitative PCR was carried out on an ABI 7500 machine (Applied Biosystems, USA) by SYBR premix EX Taq PCR kit (Takara). The primer sequences for real-time PCR were listed in Table 1 .Table 1
Primer sequences for real-time PCR.
| Target gene | Primers (5′–3′; F = forward; R = reverse) | Length |
|---|---|---|
| ALP | F: GGGCATTGTGACTACCACTCG | 21 |
| R: CCTCTGGTGGCATCTCGTTAT | 21 | |
| COL1 | F: AACAGTCGCTTCACCTACAGC | 21 |
| R: GGTCTTGGTGGTTTTGTATTCG | 22 | |
| OPN | F: ATCTCACCATTCGGATGAGTCT | 22 |
| R: TGTAGGGACGATTGGAGTGAAA | 22 | |
| OCN | F: CTGACCTCACAGATCCCAAGC | 21 |
| R: TGGTCTGATAGCTCGTCACAAG | 22 | |
| GAPDH | F: AGGTCGGTGTGAACGGATTTG | 21 |
| R: GGGGTCGTTGATGGCAACA | 19 |
ALP = alkaline phosphatase; COL1 = collagen type I; OCN = osteocalcin; OPN = osteopontin; PCR = polymerase chain reaction.
4
Osteogenic Differentiation of rBMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
rBMSCs were cocultured with different extracts and scaffolds at a density of 2 × 104 cells/well, respectively. ALP activity and ECM mineralization were evaluated after osteogenic induction. These assays were performed per the protocols mentioned in the section ‘Alkaline phosphatase activity and extracellular matrix mineralization’. The expression levels of the osteogenesis differentiation-related genes ALP, collagen type 1 (COL1), osteocalcin (OCN) and runt-related transcription Factor 2 (RUNX2) were evaluated using quantitative real-time PCR (RT–qPCR). After a 14-day incubation period in osteogenic inductive medium, total RNA was extracted from rBMSCs using TRIzol reagent (Life Technologies, USA). Subsequently, cDNA was synthesized from RNA using a SensiFAST™ cDNA Synthesis Kit (Bioline, Australia) according to the manufacturer’s guidelines. PCR amplification was performed on an ABI 7500 machine (Applied Biosystems, CA, USA) using the SYBR premix EX Taq PCR kit (Takara, Japan) with specific primer sequences detailed in Supplementary Table S1 .
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were cultured for 7 days with the above four types of media with different osmotic pressures. Then, a TRIzol reagent was used to extract total RNA. Total RNA was reverse transcribed into cDNA using a reverse transcription reagent (TaKaRa, Japan). GAPDH was used as an internal reference gene. A SYBR Premix Ex Taq PCR kit (TaKaRa, Japan) and LightCycler system (Roche, Switzerland) were used to analyze the obtained cDNA for real-time quantitative PCR (RT-qPCR). The primers used for RT-qPCR are listed in Table 1 and were synthesized by Sangon Biotech (Shanghai, China). The mRNA expression of target genes was calculated with the 2−△△Ct method.
6
Quantification of Adhesion and Osteogenesis Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT‒PCR was used to quantify the mRNA expression of adhesion-related and osteogenic differentiation-related genes in the cells of each group. After culture for 2 or 6 h, total RNA was extracted from the cells according to the manufacturer’s protocol (Takara, USA). Nanodrop plates (Tecan Infinite M200, USA) were used to measure the concentration and purity of RNA. The RNA content in each group was adjusted to 1 μg, and reverse transcription was performed using the PrimeScript RT Reagent Kit (Bio-Rad, USA). qRT‒PCR was performed with a CFX96 fluorescence quantitative PCR machine (Bio-Rad, USA), and the key adhesion-related genes integrin β1, vinculin, intercellular cell adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1) were assessed. β-actin was used as the reference gene to standardize the expression levels of other genes. The standard ΔΔCt (threshold cycle) method was used to analyze the experimental data. To detect osteogenic differentiation, the cells were cultured for 5 d following the method outlined above. qRT‒PCR was completed using a SYBR premix EX Taq PCR kit (Takara, Japan) to evaluate the mRNA levels of alkaline phosphatase (ALP), run-related transcription Factor 2 (Runx2), and osteopontin (OPN). The mRNA levels were normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
7
Quantifying IL6 mRNA Expression in Gingiva
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gingiva was stripped from the upper jaw. Total RNA was extracted, reversely translated, and semiquantified by fluorescent quantitative PCR (RNAiso Plus/PrimeScript RT reagent kit/SYBR Premix Ex Taq PCR kit, Takara Bio, Otsu, Japan) using a real-time PCR analyzing system (ViiA 7, Applied Biosystems, Waltham, MA). The mRNA level of IL6 was detected, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as endogenous control. The relative mRNA levels were calculated by 2-ΔΔCt method. The primers used were referred to in a nonprofit platform (PrimerBank, Harvard University, Cambridge, MA) as follows (5′ to 3′, forward and reverse). Gapdh, AGGTCGGTGTGAACGGATTTG and GGGGTCGTTGATGGCAACA; Il6, CTGCAAGAGACTTCCATCCAG and AGTGGTATAGACAGGTCTGTTGG.
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells with TRIzol reagent according to the manufacturer’s instructions. β-actin was used as an internal control. Real-time PCR was performed on an ABI 7500 System (Applied Biosystems, United States) by using the SYBR Premix Ex Taq™ PCR kit (TaKaRa, Dalian, China). The reverse transcription reaction conditions were as follows: 25°C for 5 min, 42°C for 30 min, and 85°C for 5 min. Real-time PCR data were analyzed using the 2−ΔΔCT method with the SDS Software package (Applied Biosystems). PCR primers were shown in Table 1 .
9
Investigating the Effect of Sa12b on NP-MSCs Apoptosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NP-MSCs from the second passage were seeded in T-25 culture flasks at a density of 5 × 105 cells/ml and cultured in 5% CO2 at 37°C at different pH levels for 7, 14, and 28 days. To observe the effect of Sa12b on cell apoptosis, the experimental group also contained Sa12b at various concentrations (2, 4, 6, and 8 μg/μl). TRIzol (Ambion, United States) was used to extract total RNA according to the manufacturer’s instructions, and the RNA samples were treated with DNase/RNase-free water. A Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, United States) was used to determine the quality and quantity of RNA. A reverse transcription reagent (Takara, Japan) was used to obtain cDNA from total RNA. A total of 1,000 ng of RNA was mixed with 2 µl of 5× PrimeScript RT®MasterMix and RNase-free ddH2O (the total system volume was 10 µl). The mixed solution was first incubated at 37°C for 15 min and then at 85°C for 5 s, and stored at −80°C for qPCR. All genes were analyzed by qPCR, and GAPDH was used as a control. SYBR Premix Ex Taq PCR kit (Takara, Japan) and LightCycler (Roche, Switzerland) were used for qPCR analysis. Premier software (version 5.0) was used to design the primers for all genes, as shown in Table 3 .
10
Quantitative Analysis of miRNA-155 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of collected rhinal tissues was extracted by TRIzol kit (Invitrogen). In brief, RNA was layered by chloroform, precipitated by isopropanol, and reversely transcribed by Oligo-dT. The optical density (OD) 260/280 value of RNA products was strictly controlled between 1.9 and 2.0. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the SYBR® Premix Ex Taq™ PCR kit (Takara).The amplification of cDNA was conducted in a thermal cycler S100 (Bio-rad) under following procedures: 95°C for 2 minutes, then 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds (40 cycles) and final incubation at 72°C for 5 minutes. The relative expression level of miRNA was calculated using the 2−ΔΔCt method. The expression level of miRNA-155 and mRNA was normalized according to the expression of U6, β-actin, respectively. The sequences of specific primers were listed in Table 2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!