The largest database of trusted experimental protocols

Biotek synergy neo microplate reader

Manufactured by Agilent Technologies
Sourced in United States

The BioTek Synergy NEO microplate reader is a versatile instrument designed for a wide range of absorbance, fluorescence, and luminescence-based applications. It features a high-performance monochromator system and capable of reading microplates of various sizes, including 6- to 384-well formats.

Automatically generated - may contain errors

3 protocols using biotek synergy neo microplate reader

1

Mitochondrial Superoxide Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The generation of mitochondrial superoxide was measured with MitoSOX Red (Invitrogen, Life Technologies, Carlsbad, CA, USA). First, the cells were incubated with MitoSOX Red at a concentration of 5 μM for 10 mins at 37°C and washed three times with Hanks Balanced Salt Solution (HBSS). The images were captured using a Bx51 fluorescence microscope (Olympus, Tokyo, Japan), and the level of fluorescence was detected using BioTek Synergy NEO microplate reader (BioTek, Vermont, USA) at 510/580 nm. For in vivo experiments, freshly isolated, frozen, and non-fixed mouse livers were incubated with MitoSOX Red (5 μM) for 10 mins at 37°C after being sectioned by cryostat at 10 μm. Then, the solution on the slides was removed, and slides were imaged with an inverted confocal microscope FV1200 (Olympus). Finally, the level of fluorescence was quantified using Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA).
+ Open protocol
+ Expand
2

Mitochondrial Potential Measurement in L-02 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tetramethylrhodamine, methyl ester (TMRM) (Invitrogen) was used to measure the mitochondrial transmembrane potential. Notably, the signal is bright in healthy cells with functioning mitochondria. Hoechst 33342 was used to stain nuclei in live L-02 cells. Cells were incubated with 100 nM TMRM for 30 mins at 37°C, after washing 3 times with HBSS, cells were then incubated with Hoechst 33342 for 10 mins at 37°C. The cells were incubated in DMEM until use and images were collected on an inverted confocal FV1200 microscope (Olympus). Finally, the fluorescence intensity was detected using BioTek Synergy NEO microplate reader (BioTek) at 548/574nm.
+ Open protocol
+ Expand
3

Truncated mouse Fzd2 gene assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The truncated mouse Fzd2 gene (Fzd2-delN) was cloned from pRK5-mFzd2 (#42254, Addgene) with a 1D4 tag at the C terminus by PCR using the following primers. SalI-mFzd2-5del-F AATAGTCGACGCCATGGGCCAGATCGAC; NotI-1D4-R aagcagcggccgcTTAGGCAGGCGCCACTTG. The resulting plasmids were transfected into HEK293 or HEK293T-FZDless [29] (gift from Dr. Benoit Vanhollebeke, Université libre de Bruxelles, Belgium) expressing a Wnt reporter gene (super top flash, STF) with X-tremeGENE HP DNA Transfection Reagent (Roche). The luciferase activity was detected 48 hours after transfection using the luciferase assay system (Promega) and a BioTek Synergy Neo Microplate Reader (BioTek).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!