Lightercycler 480

RNA was extracted from FAK-WT and FAK-KD MDA-MB-231 cells using the RNeasy Kit (Qiagen). NS and actin (used as normalization control) were amplified with specific primers (below). For PCR we used 480 SYBR green master mix (BioPioneer) with a LighterCycler 480 (Roche). Cycle conditions were 40 cycles of 94°C for 15 s, 56°C for 30 s, and 72°C for 30 s. The normalized mRNA level was defined as DCt = (target gene)-Ct (reference gene) and presented as fold difference between control and test samples (DCt control-DCt test). Actin forward 5′ GCGAGCACAGAGCCTCGCCTTTG 3′, actin reverse 5′ ACGACGAGCGCGGCGATATCAT 3′, NS forward 5′ TATCCATGGGGCTTACAAGG 3′ and NS reverse 5′ CTGGACTTCGCAGAGCAAG 3′.

Total RNA was extracted from the cells using the Trizol Reagent and its concentration and quality was measured using NanoDrop 2000. The total RNA was reversely transcripted into cDNA using the SuperScript III Reverse Transcriptase (Invitrogen). The primers (Shh, Ihh, Dhh, E-cadherin, MMP-2, and GAPDH) for reverse transcription and qPCR of miR-338-5p and U6 (Table 1) were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. (Guangzhou, China). Invitrogen's Platinum SYBR Green qPCR SuperMix-UDG kit was used in this reaction. The specificity of SYBR Green qPCR was validated using melt curve analysis. qPCR was performed using the following: reagent used was 10 μL of Platinum® SYBR® Green qPCR (Invitrogen), 1 μL of forward primer, 1 μL of reverse primer, 2 μL of cDNA template, and 6 μL RNase free ddH₂0. U6 and GAPDH were used as controls. Real-time PCR reaction conditions were set as follows: Roche LighterCycler 480 denaturation was set to 95°C for 30 seconds and cycle amplification conditions were set to 95°C for 5 seconds and 60°C for 30 seconds for a total of 40 cycles. The 2^−∆∆C_T method was used to calculate the relative expression level of miR-338-5p, Shh, Ihh, Dhh, E-cadherin, and MMP-2 in glioma cells.